Elements for physics quantities, qualities and intrinsic theories a tarantola
Elements for physics quantities, qualities and intrinsic theories a tarantola
... them, according to the problem at hand. Consider a p-dimensional autovector space A and a q-dimensional au- tovector space V . The autovectors of A are denoted a , b . . . , and the o-sum and o-difference ... implications in physics. As soon as we accept that behind the usual physical quantities there are quality spaces, that usual quantities are only special ‘coordinates’ ove...
Ngày tải lên: 17/03/2014, 14:51
Rapid assessment tool for Sexual & reproductive HealtH and Hiv linkages: a generic guide pot
... intercourse and how does this compare to the usual age of sexual debut? To what extent are the above legal ages respected and/ or monitored? What are the laws affecting key groups (a. SWs, ... impact? Within the broader SRH operational plan, are there any explicit activities to improve access, coverage and quality of care, including for HIV, for: General population...
Ngày tải lên: 14/03/2014, 15:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Free ligands were adsorbed on charcoal, and the absorbance spectra were recorded. Concentration of appearing IF–CNCbl was calculated by comparison with the standards IF–H 2 OCbl and IF–CNCbl according ... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Seque...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo y học: "Application of Small Angle X-ray Scattering (SAXS) for Differentiation between Normal and Cancerous Breast Tissue"
... of Small Angle X-ray Scattering (SAXS) for Differentiation between Normal and Cancerous Breast Tissue Vahid Changizi 1 , Mohammad A. Oghabian 1 , Robert Speller 2 , Saeed Sarkar 1 , Ali Arab ... mastectomy at the Imam Khomaini hospital, Tehran, Iran. A section from each sample was sent for histological analysis whilst the remaining tissue was prepared for scatter analysis. All...
Ngày tải lên: 02/11/2012, 11:08
Ethernet networking for the small office and professional home office
... Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com Simpo PDF Merge and Split Unregistered ... http://www.simpopdf.com Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com Simpo PDF Merge and Spli...
Ngày tải lên: 21/08/2013, 08:05
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... local stakeholders, and water quality analysis of the biogas plants were conducted. BACKGROUND Study area Bangladesh lies in the northeastern part of South Asia, and has an area of ... at the stage of planning and implementation of water and sanitation options. Educational intervention on water and sanitation: 1995-1997. The educational intervention on water and s...
Ngày tải lên: 05/09/2013, 09:08
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... GGCTACCTTGTTACGACTT Lane (1991) PAO651f Candidatus ‘Accumulibacter phosphatis’ CTGGAGTTTGGCAGAGGG This study PAO846r Candidatus ‘Accumulibacter phosphatis’ GTTAGCTACGGCACTAAAAGG This study PAO462 Candidatus ... Candidatus ‘Accumulibacter phosphatis’ CCGTCATCTACWCAGGGTATTAAC Crocetti et al . (2000) PAO651 Candidatus ‘Accumulibacter phosphatis’ CCCTCTGCCAAACTCCAG Crocetti et al. (2000) PAO846 C...
Ngày tải lên: 05/09/2013, 09:38
Numerical simulation and optimization of CO2 sequestration in saline aquifers for enhanced storage capacity and secured sequestration
... Khalid A. A Numerical Simulation Framework for the Design, Management and Optimization of CO2 Sequestration in Subsurface Formations. Global Climate and Energy Project (GCEP) Report, Stanford, ... making it easier for CO 2 to travel in the lateral direction than upward. Geological characterizations of various saline aquifers have shown that in the actual aquifers the horizontal...
Ngày tải lên: 05/09/2013, 16:10