The Crime Against Europe A Possible Outcome of the War of 1914 doc
... the Frank Kingdom of Jerusalem. The occupation by the fair-haired peoples of the Baltic and North Seas of the lands of Turk and Tartar, of Syrian and Jew, of Armenian and Mesopotamian, was never a ... impunity and to call up war from the ends of the earth while they themselves enjoy the blessing of peace. England, the soul and brain of this confederacy...
Ngày tải lên: 17/03/2014, 13:20
... FEBS naya OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367. 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelia...
Ngày tải lên: 19/02/2014, 06:20
... DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about twice that of wild-type E1. The single mutants E1aR26 7A and E1aD27 6A and the multiple mutants E1aY28 1A/ R28 2A/ S28 3A and ... in a loop at the entrance to the active site (Fig. 1), as the main cleavage sites. Cleavage of the E 1a- subunit activated the enzyme, as determined b...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu CHILDREN’S HEALTH AND THE ENVIRONMENT IN EUROPE: A BASELINE ASSESSMENT doc
... Agency, Barcelona, Spain Miguel Angel Espinosa Martinez a Andalusian School of Public Health, Granada, Spain Alejandro Lopez Ruiz a Andalusian School of Public Health, Granada, Spain ˇ VORSPANN_final_final ... Science and Environmental Protection, Belgrade, Serbia Katarina Halzlová a National Public Health Authority, Bratislava, Slovakia Martin Kapasny a State Health Institute, Z...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre. Sulfated and nonsulfated glycosaminoglycans from the supernatant were estimated ... [61]. The characterization of the proteins associated to this complex by amino acid analysis of the precipitate after two deacetylation steps revealed the predominan...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the ... (5¢-CACGC AAGCTTCT CTTGAGTCTCTATGAAGG-3¢)andthe5¢ specific oli- gonucleotides (5¢-CCGGAGCTC GAGACTCTTAGTAA ATGTGCCCC-3¢) for amplification of the fragment fro...
Ngày tải lên: 08/03/2014, 10:20
The road to reality a complete guide to the laws of the universe penrose, roger
... and have come to the conclusion that what I have to say cannot reasonably be conveyed without a certain amount of mathematical notation and the exploration of genuine mathematical concepts. The ... rational hang-up—one that with all my mathematical glibness I had not noticed. There is, indeed, a profound issue that one comes up against again and again in mathematics and in mat...
Ngày tải lên: 17/03/2014, 14:53
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... 8004–8012. 4 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K & Shen J-R (1995) Isolation and characterization of a photosystem II complex from the red alga Cyanidium caldarium: association of cytochrome ... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Nishida K, Yoshida Y et al. (2004) Genome sequence of the ultrasmall unicellular red alga Cyanidiosch...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... pCA(D24 8A) forward primer, 5¢-CCTAATCATTTTAGGGGT GCCCA CACATATGTCCCTGTGAC-3¢ (the reverse primer was the complementary sequence); pCA(K45 5A) forward pri- mer, 5¢-CATCTTGAAAGTCGGT GCGGGAGAAGCAA CACAATGC-3¢ ... 5¢-CATCTTGAAAGTCGGT GCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGA GCAGCAACACAATGC-3¢ (the...
Ngày tải lên: 30/03/2014, 11:20