Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

... 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48 N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43 N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ ... 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58 R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55 R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGA...

Ngày tải lên: 17/03/2014, 10:20

... Methanosarcina barkeri) or directly after the thioglycine (Methanosarcina barkeri), and an alanine instead of an aspartate two positions from the thioglycine (Methanopyrus kandleri). The cysteine ... [2]. Methanogenic archaea and methanotrophic archaea all belong to the kingdom of Euryarchaeota. They are classified on the basis of their 16S RNA sequence in five orders, Methano...

Ngày tải lên: 16/03/2014, 05:20

... Indeed, the change in the array of the hydrogen bonds at thymine of SRE GGfos is probably a sign of perturbation in the hydration scheme along the minor groove of the (A ⁄ T) domain. The G–C base pair ... strain There are several indications of a redistribution of the strains exerted on the oligonucleotide by the bend: partial unstacking of some aden...

Ngày tải lên: 07/03/2014, 09:20

... the glutamate that acts as the catalytic acid. The active site grooves of these chitinases are lined with aromatic amino acids that contribute to substrate binding [6,11]. Catalysis in retaining ... Family 18 chitinases are retaining glycoside hydrolases that have been found in many organisms varying from bacteria to humans [1,2]. The catalytic domains of family 18 chiti...

Ngày tải lên: 07/03/2014, 14:20

... the indanone and the phenyl ring of E2020 is shorter than the distance between the active- site and the peripheral anionic site, E2020 can either bind at the active site or at the peripheral anionic ... the active- site and the peripheral ani- onicsiteinAChE,butinthecaseofBChE,asthegorgeis larger, E2020 cannot simultaneously interact at both sites. The observa...

Ngày tải lên: 30/03/2014, 20:20

... Invitrogen (Burlington, Canada); Oil Red O, Harris hematoxylin, polyornithine and laminine from Sigma (Oakville, Canada); formalin from Fisher Scientific (Nepean, Canada); Alamar blue reagent from ... were then removed and placed into scintillation vials containing scin- tillation liquid (ScintiSafe Plus 50%, Fisher Scientific Canada, Ottawa, Canada). Radioactivity was counted 24 h later, using...

Ngày tải lên: 07/03/2014, 00:20

... simulation of the EPR spectra of reacting holoenzymes, it was suggested that that the distances between Co(II) of cob(II)alamin and substrate radicals are  11 A ˚ in ethanolamine ammonia-lyase ... adeninylpropylcobalamin and other longer chain homologues do not [32]. These lines of evidence suggest the presence of adenine-binding site in the apo- enzyme and that...

Ngày tải lên: 07/03/2014, 21:20

... play a vital role in providing acetyl-CoA and oxaloacetate in the cytosol as starting materials for a variety of biosynthetic pathways. Rat and human ACLs from various organs and tissues have ... Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synt...

Ngày tải lên: 08/03/2014, 22:20

... cleavage site in the MCA substrate. Extended incubation and examination of the products of Fig. 2. Percentage activity of wild-type TOP with the substrates MCA, mcaBk, mcaGnRH 1–9 and mcaNt in the ... (CACCTCACTCCACAAGTAAGCATAGT ACTGAGCGTCGTA); FwRepG60 3A (CTTTTGGCCA CCTCGCTGCTGGCTACGACGCTCAGTAC); RvRepG- 60 3A (GTACTGAGCGTCGTAGCCAGCAGCGAGGTG GCCAAAAG); FwRepG60 4A (G...

Ngày tải lên: 23/03/2014, 06:20

... linear kine- tics range. Mechanistically, Fpg and OGG1 differ in their ability to catalyze cleavage of the apurinic ⁄ apyri- midinic (AP) site via elimination of its 3¢-phosphate (AP lyase activity) ... assay endpoints were used in this case: glycosylase activity was measured after full thermal degradation of the AP site left by base excision, whereas the AP lyase activity...

Ngày tải lên: 18/02/2014, 18:20