Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris Masahiro Sugimura 1 , Hirofumi Watanabe 1 , Nathan ... endo-b-1, 4-glucanase and b-glucosidase, have been detected in the gut of P. hilaris larvae and adults [8]. To clarify further the cellulase activi...

Ngày tải lên: 17/03/2014, 10:20

... 2400 VÆh )1 at a constant power of 18 W, at 10 °C and continuous buffer circulation in a DESAGA VA-200 apparatus (DESAGA, Germany). After separ- ation, the protein bands were cut out and the gel ... spectra after alternative irradiation with the two light qualities. Mass spectrometry and N-terminal amino acid sequencing Mass spectrometry of the a- PEC peptides origina...

Ngày tải lên: 17/03/2014, 10:20

... bp of the 5¢ untranslated regions and the 3¢ untranslated regions containing polyadenylation signals (AATAAA) at three positions and the poly (A) -tails. The criteria for a consensus translation ... lLofwater. First strand cDNAs for 5¢ -and3 ¢-RACE were prepared from the ink sac poly (A) + RNA using a SMART RACE cDNA Amplification kit (Clontech, Palo Alto, CA, USA) acc...

Ngày tải lên: 17/03/2014, 10:20

... M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but not syn- thetic ... China Sea. Sephadex G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX 300SB-C18 semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and tr...

Ngày tải lên: 18/02/2014, 17:20

... number AI563351) was used to design four GAT-specific primers; CLGAT 5a (5¢-GGCATCAACAT- CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT- CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) ... FEBS Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon Kentaro Takahara, Kinya Akashi and Akiho Yokota Gradu...

Ngày tải lên: 20/02/2014, 03:20

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from 1 g of abalone...

Ngày tải lên: 20/02/2014, 23:20

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya Suriya Department ... SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, Parate...

Ngày tải lên: 21/02/2014, 00:20

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... with g values at 2.031, 1.994, and 1.951. The resonance started to develop at potentials ‡ 0 mV and was stable at potentials up to +350 mV. The loss and formation of...

Ngày tải lên: 21/02/2014, 03:20

... forward: 5¢-CTGAACT TCTCTACACACTGAGG-3¢, reverse: 5¢-CCTTATCACC ATCACCTCACTTC-3¢; ZHE2 forward: 5¢-CTCCACACA CTGAGACTAAATGG-3¢, reverse: 5¢-GGAAATAAGAG CACGTACTGTGG-3¢. The cycle number of PCR was ... Most of the activity was retained in the column and eluted at the concen- tration of approximately 0.35 m NaCl as a sharp single peak. SDS ⁄ PAGE of the active fraction gav...

Ngày tải lên: 07/03/2014, 04:20

... translation showed that they hold the characteristic features of all known papain-class cysteine proteinases, and a phylogenetic analysis revealed the existence of several papain and chymopapain ... complete cDNAs from papain, glycyl endopeptidase, two iso- forms of caricain and five isoforms of chymopapain from C. papaya. From the genus Vasconcellea, only the lat...

Ngày tải lên: 07/03/2014, 11:20