Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

... 5¢-TTTAATACGACTCACTAT AGGGTGCTCGCTTCGGCA-3¢ as upstream primer and 5¢-TATGGAACGCTTCACGAATT-3¢ (U6- 0), 5¢-ATAT GGAACGCTTCACGAATT-3¢ (U6- 1) or 5¢-AATATGG AACGCTTCACGAATT-3¢ (U6- 2) as downstream primer, respectively. ... HeLa cell terminal uridylyltransferase (TUTase) that specifically modifies the 3¢-end of mammalian U6 small nuclear RNA (snRNA) was characterized with respect to io...

Ngày tải lên: 17/03/2014, 09:20

10 531 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu O f...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... their absorbance at 260 nm. Peak 3 produced small amounts of HMG-CoA and large amounts of free CoA. Peak 4 produced HMG-CoA and also large amounts of free CoA. Peak 5 produced large amounts of HMG-CoA, ... (1999) Characterisation and mitochondrial localisa- tion of AUH, an AU-specific RNA-binding enoyl-CoA hydratase. Gene 228, 85–91. 17 Nakagawa J & Moroni C (1997) A 20-amino...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosome was amplified by PCR using chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTG GGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTT GTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction ... human pathogens. Enterococci and Staphylococci have a dramatic history of resistance development against virtually all currently avail- able antibiotics. Most notably,...

Ngày tải lên: 19/02/2014, 13:20

12 693 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

... identifi- cation was performed by searching the MS data against a curated version of the International Protein Index Biochemical characterization of USP7 A. Ferna ´ ndez-Montalva ´ n et al. 4266 ... supplementary material is available online: Fig. S1. Analysis of USP7 oligomerization in vitro and in cells. Fig. S2. Substrate titrations of USP7 variants. This material is availabl...

Ngày tải lên: 07/03/2014, 05:20

15 593 0
Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

... CCAACTTATGTCCCGACT CTGCATCTGTGAAAGT CaDHODH-rev, CCGGAATTCCTTATCATCAGAG CCAATTAT Ca-BamHI-for, GCGGATCCCGAATGTTTCGTCC AAGTATCAAATTCAAACAGTCG Cak-BamHI-for, GCGGATCCCGAATGTCAAGAT CAGCAATCCATGAATATGTTTTGTGC CaDHODH-rev3, CCGGAATTCTCACTTATCATC AGAGCCAATTATTTGCTCCCATG Expression ... ATGTTTCGTCCAAGTATCAAAT TC ZGCaURA1–3¢, TCACTTATCATCAGAGCC Ca-forlong2, ATGTTTCGTCCAAGTATCAAATTC AAACAGTCGACTTTGTCC...

Ngày tải lên: 07/03/2014, 12:20

9 458 0
Báo cáo khoa học: Biochemical characterization of annexin B1 from Cysticercus cellulosae pdf

Báo cáo khoa học: Biochemical characterization of annexin B1 from Cysticercus cellulosae pdf

... of annexin proteins in health and disease are increasingly being appreciated and the term ‘annexinopathies’ has been put forward for annexin- related diseases. In particular, the importance of annexin ... affinity of the interaction with heparin. Subsequent binding of annexin A5 to the membrane surface releases the glycosaminoglycan from A. Winter et al. Biochemical characterizati...

Ngày tải lên: 07/03/2014, 12:20

10 388 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... filtration chromatography and GLC were carried out as described previously [16]. Preparation of OS material O-Deacylation of LPS. O-Deacylation of LPS was achieved wi...

Ngày tải lên: 08/03/2014, 02:21

13 433 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ....

Ngày tải lên: 08/03/2014, 10:20

11 502 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... M. K. Islam 1 , M. A. Alim 1 and Kozo Fujisaki 2,3 1 Laboratory of Parasitic Diseases, National Institute of Animal Health, Ibaraki, Japan 2 National Research Centre for Protozoan Diseases,...

Ngày tải lên: 16/03/2014, 10:20

14 433 0
w