Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot
... gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... ation. Moreover, this data disproves B/~uerle's explana- tion of (1), clarifies Smith's definition of a viewpoint and motivates the need for a neutral viewpoin...
Ngày tải lên: 17/03/2014, 09:20
... Bolt, Beranek and Newman, Inc. Cambridge, MA 02239 Kathy Starr Bolt, Beranek and Newman, Inc. Cambridge, MA 02239 ABSTRACT A desirable long-range goal in building future speech understanding ... Norma Peterson, and Mike Nivens for helping to organize the experiment and transcript preparation. Than~s also go to Sharon Oviatt, Marilyn Adams, Chip Bruce, Andee Rubin, Pay Per...
Ngày tải lên: 21/02/2014, 20:20
... users' grammatical and ungrammatical forms demonstrates the sufficiency of a very restricted grammar of English for a natural language interface to an advisory sys* tem. The users' language ... strategies to handle ungrammatical input, and some parsing heuristics portable to any natural language interface to advisory systems. This strategy would increase the habitabili...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: Crystal and solution structure, stability and post-translational modifications of collapsin response mediator protein 2 pdf
... Kaul P, Sathish HA & Prakash V (2002) Effect of metal ions on structure and activity of papain from Carica papaya. Nahrung 46, 2–6. 35 Akhtar MS, Ahmad A & Bhakuni V (2002) Divalent cation ... Uchida Y, Ohshima T, Sasaki Y, Suzuki H, Yanai S, Yamashita N, Nakamura F, Takei K, Ihara Y, Mikoshiba K et al. (2005) Semaphorin 3A signalling is mediated via sequential Cdk5 and GSK3b...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... by measurement of anomeric protons area. This led to 14 possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, ... bold): B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, A A B (Table 1). In summary, eight of the 14 possible combinations could be as...
Ngày tải lên: 31/03/2014, 09:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nucleotide-free forms. ... the a, b and c subunits of the enzyme are abbreviated as a D , b D , and c D , respectively, and the a and b subunits of the reactivase are abbrevi- ated as a R...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... DNA sequences flanking the Jannaschia sp. CCS1 HYD Js revealed an ORF encoding a putative allantoate amido- hydrolase, which is part of the urate catabolic pathway in many organisms [8]. In fact, ... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a-...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium SurE...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATC...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ were ... points over 60 s, and an average value was taken as a data point. Titrations were continued until a stable anisotropy value was obtained. Fluorescence anisotropy, A, is defined as A ¼ðI...
Ngày tải lên: 19/02/2014, 06:20