Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot
Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot
... gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... ation. Moreover, this data disproves B/~uerle's explana- tion of (1), clarifies Smith's definition of a viewpoint and motivates the need for a neutral viewpoint in German. It is ... Holt and the three anonymous reviewers of this paper. This research was supported by a PhD-scholarship HSPII/AUFE awarded by the German Academic Exchange Service (DAAD). 1Besides the situation...
- 3
- 254
- 0
Tài liệu Báo cáo khoa học: "DEPENDENCIES OF DISCOURSE STRUCTURE ON THE MODALITY" potx
... Bolt, Beranek and Newman, Inc. Cambridge, MA 02239 Kathy Starr Bolt, Beranek and Newman, Inc. Cambridge, MA 02239 ABSTRACT A desirable long-range goal in building future speech understanding ... Norma Peterson, and Mike Nivens for helping to organize the experiment and transcript preparation. Than~s also go to Sharon Oviatt, Marilyn Adams, Chip Bruce, Andee Rubin, Pay Perrault, Candy ... informs a hearer about a state-of-affairs for which it is shared knowledge that the hearer has better evidence, then the speaker is actually requesting confirmation of that state-of-affairs....
- 8
- 459
- 1
Báo cáo khoa học: "GRAMMIATICAL AND UNGRAMMATICAL STRUCTURE SINUSER - ADVISER DIALOGUES1 EVIDENCE FOR SUFFICIENCY OF RESTRICTED LANGUAGE SINNATURAL LANGUAGE INTERFACES TO ADVISORY SYSTEMS." potx
... users' grammatical and ungrammatical forms demonstrates the sufficiency of a very restricted grammar of English for a natural language interface to an advisory sys* tem. The users' language ... strategies to handle ungrammatical input, and some parsing heuristics portable to any natural language interface to advisory systems. This strategy would increase the habitability of the natural ... English, usually associated with a par- ticular domain or trade that have been called sublanguages (Harris, 1968; Kittredge, 1982). Sublanguages are charac- terized by distinctive specialized...
- 4
- 414
- 0
Báo cáo khoa học: Crystal and solution structure, stability and post-translational modifications of collapsin response mediator protein 2 pdf
... Kaul P, Sathish HA & Prakash V (2002) Effect of metalions on structure and activity of papain from Caricapapaya. Nahrung 46, 2–6.35 Akhtar MS, Ahmad A & Bhakuni V (2002) Divalentcation ... Uchida Y, Ohshima T, Sasaki Y, Suzuki H, Yanai S,Yamashita N, Nakamura F, Takei K, Ihara Y,Mikoshiba K et al. (2005) Semaphorin 3A signalling is mediated via sequential Cdk5 and GSK3betaphosphorylation ... materials for this study and thebeamline staff at EMBL Hamburg and MAX-Lab forenabling smooth data collection. The measurement ofsynchrotron SAXS data at EMBL Hamburg and thecrystallographic...
- 14
- 431
- 0
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... bymeasurement of anomeric protons area.This led to 14 possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha)B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, ... bold):B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, A A B (Table 1).In summary, eight of the 14 possible combinations couldbe assigned by NMR, as illustrated ... A A B A A B A A, A A B A AvB A A and A A B– A A B A A (B: b-Rhap ,A: a-Rhap, A: a- Fucp3NAc(1fi2 )a- Rhap). The phi and psi angles aredefined by H1–C1–O1–CX and C1–O1–CX–HX, respect-ively, where X is the position...
- 9
- 454
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... K, Hieda N, Yamanishi M, Shibata N &Toraya T (2005) Crystallization and preliminary X-rayanalysis of molecular chaperone-like diol dehydratase-reactivating factor in ADP-bound and nucleotide-freeforms. ... the a, b and c subunits of theenzyme are abbreviated as a D, bD, and cD, respectively, and the a and b subunits of the reactivase are abbrevi-ated as a R and bR, respectively, molar ratios ... Bando R, Hieda N & Toraya T (2004)Identification of a reactivating factor foradenosylcobalamin-dependent ethanolamine ammonialyase. J Bacteriol 186, 6845–6854.27 Baker JJ & Stadiman...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... DNAsequences flanking the Jannaschia sp. CCS1 HYDJsrevealed an ORF encoding a putative allantoate amido-hydrolase, which is part of the urate catabolic pathwayin many organisms [8]. In fact, ... molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. ... ofmicrobial hydantoin-transforming enzymes. J Mol CatalB Enzym 2, 163–176.13 Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-ysis to amino acid-based chiral pharmaceuticals - exam-ples and...
- 14
- 621
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... pro-tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 FEBS Journal 275 (2008) ... is a functional relationship betweenSurE and Pcm. l-isoaspartate O-methyltransferaseconverts isoapartyl residues to l-aspartyl residues and thereby repairs damaged proteins that can accumulatewith...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... an N-terminal Nco1 cloning site.The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and thereverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3¢ were ... pointsover 60 s, and an average value was taken as a data point.Titrations were continued until a stable anisotropy valuewas obtained.Fluorescence anisotropy, A, is defined as A ¼ðIV IHÞ=ðIVþ ... puri-fied, and annealed. The Not1 site in the resulting genewas removed using the complementary oligomers5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAACCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAATTATCGCCCCTCCCGCC-3¢...
- 10
- 647
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ