Báo cáo khoa học: " Teaching a Weaker Classifier: Named Entity Recognition on Upper Case Text" docx
Báo cáo khoa học: " Teaching a Weaker Classifier: Named Entity Recognition on Upper Case Text" docx
... Teaching a Weaker Classifier:
Named Entity Recognition on Upper Case Text
Hai Leong Chieu
DSO National Laboratories
20 Science Park Drive
Singapore 118230
chaileon@dso.org.sg
Hwee Tou Ng
Department ... require
case information.
Among local features, Case and Zone, InitCap-
Period, and OneCap are not used by the upper case
NER. Among global features, only Other-CS an...
Tài liệu Báo cáo khoa học: "Mining Wiki Resources for Multilingual Named Entity Recognition" pdf
... is a dominant type. For instance,
the page “Amanda Foreman” is a disambiguation
page, with each link on the page leading to an
easily classifiable article.
Finally, we use Wiktionary, an online ... human-annotated corpora,
comparable to a system trained on up to
40,000 words of human-annotated newswire.
1 Introduction
Named Entity Recognition (NER) has long been a
m...
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc
... grammatical function
of the constituents, we have to take into account
that the extraction is an approximation. There are
various phenomena that can lead us to an erroneous
extraction of the constituents. ... measure are the 3-way and 15-way classifica-
tions. The baseline is calculated, for each task, as
the average value of the Adjusted Rand measure for
100 random cluster assignations. Altho...
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... tetrapeptide is assembled by the nonribosomal
peptide synthetase EtcD, involving unusual initiation- and cyclorelease-
mechanisms.
Abbreviations
A, adenylation domain; ac-haOrn, a- N-acetly-d-N-acetyl-d-N-hydroxyornithine; ... utilizing a novel radio-LC-MS-guided
genome mining methodology. Structural and func-
tional characterization was carried out relying on
NMR and MS
n
analysis and...
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
... the ACL Interactive Poster and Demonstration Sessions,
pages 89–92, Ann Arbor, June 2005.
c
2005 Association for Computational Linguistics
Transonics: A Practical Speech-to-Speech Translator ... integration and evaluation can also be
found in the papers just cited.
The MT components, as noted, consist of both a
Classifier and a stochastic translation engine, both
1
Standardized Pati...
Tài liệu Báo cáo khoa học: "Evaluating the Accuracy of an Unlexicalized Statistical Parser on the PARC DepBank" docx
... by
Kaplan et al., and finally overall macro- and mi-
croaverages. The macroaverage is calculated by
taking the average of each measure for each indi-
vidual relation and feature; the microaverage ... than 0.5% to accuracy on in-domain
data while lexical subcategorization-like parame-
ters contribute just over 1%.
Several alternative relational evaluation
schemes have been developed (e.g. Car...
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,
Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-
ama O, Takahashi K et al. (1989) Molecular cloning
and sequence analysis of cDNA for human hepatocyte
growth factor. ... Yokohama, Japan
2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan
Introduction
Type II transmembrane serine proteases (TT...
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... min
PAGE
Pipet to plate, add A beads and incubate
+16 h
D
1 h
Autoradiography
Add D beads and incubate
D A
O
2
Read AlphaLISA si
g
nal at 615 nm
HSE
Fig. 1. Comparison of EMSA and TransLISA for ... AGCTGATCTTCGAAGATCTTCGAAGAT
Mutated HSE
sense
Biotin-TCGACTT
CAAGCTTGTACAAGCTTGTAG
Mutated HSE
antisense
AGCTGAAGTTCGAACATGTTCGAACATC
‘Scrambled’
oligonucleotide
Biotin-AACGACGGTCGCTCCGCCTGGCT...
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami
A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,
Hamasaki K et al. (2003) Interferon -a sensitizes human
hepatoma cells to TRAIL-induced apoptosis ... combination of IFNa and TRAIL,
relative to TRAIL alone.
In view of the cleavage of caspase substrates such as
BID and PARP, the effect of IFNa and TRAIL on
the DNA content of MCF-7 cells was a...
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA
TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and
PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG
AATTCCATATGAAGAATGATCAATCTGGCTGCG
GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG
TTCCCTGTCCAGTGTTACC-3¢. ... The African trypanosome
Trypanosoma brucei is the protozoon that causes the fatal
human sleeping sickness, as well as Nagana, a devasta...