Báo cáo khoa học: " Teaching a Weaker Classifier: Named Entity Recognition on Upper Case Text" docx
... Teaching a Weaker Classifier: Named Entity Recognition on Upper Case Text Hai Leong Chieu DSO National Laboratories 20 Science Park Drive Singapore 118230 chaileon@dso.org.sg Hwee Tou Ng Department ... require case information. Among local features, Case and Zone, InitCap- Period, and OneCap are not used by the upper case NER. Among global features, only Other-CS an...
Ngày tải lên: 17/03/2014, 08:20
... is a dominant type. For instance, the page “Amanda Foreman” is a disambiguation page, with each link on the page leading to an easily classifiable article. Finally, we use Wiktionary, an online ... human-annotated corpora, comparable to a system trained on up to 40,000 words of human-annotated newswire. 1 Introduction Named Entity Recognition (NER) has long been a m...
Ngày tải lên: 20/02/2014, 09:20
... grammatical function of the constituents, we have to take into account that the extraction is an approximation. There are various phenomena that can lead us to an erroneous extraction of the constituents. ... measure are the 3-way and 15-way classifica- tions. The baseline is calculated, for each task, as the average value of the Adjusted Rand measure for 100 random cluster assignations. Altho...
Ngày tải lên: 08/03/2014, 04:22
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... tetrapeptide is assembled by the nonribosomal peptide synthetase EtcD, involving unusual initiation- and cyclorelease- mechanisms. Abbreviations A, adenylation domain; ac-haOrn, a- N-acetly-d-N-acetyl-d-N-hydroxyornithine; ... utilizing a novel radio-LC-MS-guided genome mining methodology. Structural and func- tional characterization was carried out relying on NMR and MS n analysis and...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
... the ACL Interactive Poster and Demonstration Sessions, pages 89–92, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics Transonics: A Practical Speech-to-Speech Translator ... integration and evaluation can also be found in the papers just cited. The MT components, as noted, consist of both a Classifier and a stochastic translation engine, both 1 Standardized Pati...
Ngày tải lên: 08/03/2014, 04:22
Tài liệu Báo cáo khoa học: "Evaluating the Accuracy of an Unlexicalized Statistical Parser on the PARC DepBank" docx
... by Kaplan et al., and finally overall macro- and mi- croaverages. The macroaverage is calculated by taking the average of each measure for each indi- vidual relation and feature; the microaverage ... than 0.5% to accuracy on in-domain data while lexical subcategorization-like parame- ters contribute just over 1%. Several alternative relational evaluation schemes have been developed (e.g. Car...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (TT...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... min PAGE Pipet to plate, add A beads and incubate +16 h D 1 h Autoradiography Add D beads and incubate D A O 2 Read AlphaLISA si g nal at 615 nm HSE Fig. 1. Comparison of EMSA and TransLISA for ... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... combination of IFNa and TRAIL, relative to TRAIL alone. In view of the cleavage of caspase substrates such as BID and PARP, the effect of IFNa and TRAIL on the DNA content of MCF-7 cells was a...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... The African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devasta...
Ngày tải lên: 19/02/2014, 12:20