Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

... JaBot: a multilingual Java-based intelligent agent for Web sites Tim READ & Elena BARCENA Departamento de Filologias Extranjeras y sus Lingi isticas, UNED Senda del Rey s/n, Madrid ... of usage, and distributed operation across the Web (Read et al., 1997). These benefits make Java an ideal programming language for constructing Web- based computational linguistic...

Ngày tải lên: 17/03/2014, 07:20

5 230 0
Báo cáo khoa học: "Investigating a Generic Paraphrase-based Approach for Relation Extraction" pdf

Báo cáo khoa học: "Investigating a Generic Paraphrase-based Approach for Relation Extraction" pdf

... relative to a standard application dataset. It is also the first evaluation of a generic paraphrase-based approach for the stan- dard RE setting. Our findings are encouraging for both goals, particularly ... works on paraphrasing (http://nlp.nagaokaut.ac.jp/IWP2005/). 410 lation. Ravichandran and Hovy (2002) evaluated the performance of a QA system that is based solely on paraphrases,...

Ngày tải lên: 31/03/2014, 20:20

8 230 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call "pivot". ... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different...

Ngày tải lên: 22/02/2014, 02:20

4 479 0
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt

Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt

... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call "pivot". ... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different...

Ngày tải lên: 08/03/2014, 21:20

4 353 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves- tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...

Ngày tải lên: 20/02/2014, 05:20

6 449 0
Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf

Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf

... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... E-mail: nakano@atom.brl.ntt.co.jp, shimazu@jaist.ac.jp Abstract This paper proposes a method for generating a logical- constraint-based internal representation from a unifica- tion gram...

Ngày tải lên: 20/02/2014, 18:20

5 303 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for exam- ple, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive...

Ngày tải lên: 20/02/2014, 18:20

5 528 0
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach...

Ngày tải lên: 20/02/2014, 21:20

8 412 0
w