Báo cáo khoa học: "HAHAcronym: A Computational Humor System" potx

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

... su- perlatives have mainly focused on particular se- mantic properties that may only rarely occur in natural language (Szabolcsi, 1986; Heim, 1999). My goal is a comprehensive computational treatment ... IS -A relation that holds between target and comparison set (cf. Relation 2 in Section 3). They 68 are a good initial focus for a computational ap- proach because both their t...
Ngày tải lên : 20/02/2014, 12:20
  • 6
  • 446
  • 0
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

... Grammatical Relations, MIT Press, Cambridge. Carbonell, J., and Hayes, P. (1983). "Recovery Strategies for Parsing Extragrammatical Lan- guage", American Journal of Computational ... example, the various categorial unification ap- proaches, such as Unification Categorial Gram- mar (Zeevat, Klein, and Calder, 1987)). Even when a syntactic skeleton is assumed, some approa...
Ngày tải lên : 20/02/2014, 21:20
  • 8
  • 376
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... K., Miyashita, K., Fujii, T., Sakai, H., Uchida, M. & Tanaka, H. (1993) Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of Bacillus circulans WL- 12 as essential residues ... DXDXE motif that spans strand 4 of the TIM barrel and includes the glutamate that acts as the catalytic acid. The active site grooves of these chitinases are lined with aromatic amino acids...
Ngày tải lên : 07/03/2014, 14:20
  • 10
  • 651
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (TT...
Ngày tải lên : 15/02/2014, 01:20
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...
Ngày tải lên : 16/02/2014, 09:20
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...
Ngày tải lên : 18/02/2014, 14:20
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...
Ngày tải lên : 19/02/2014, 06:20
  • 11
  • 679
  • 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...
Ngày tải lên : 19/02/2014, 12:20
  • 11
  • 566
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-...
Ngày tải lên : 19/02/2014, 12:20
  • 10
  • 500
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

... Victoria, Australia 3 INSERM U428, Faculte ´ de Pharmacie, Universite ´ Paris V, Paris, France 4 Departments of Pathology and Laboratory Medicine, Pharmacology, and Medicine, Carolina Cardiovascular ... FEBS (GAGs) [3]. Glycosaminoglycans such as heparin, hep- aran sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases...
Ngày tải lên : 20/02/2014, 02:21
  • 10
  • 668
  • 0

Xem thêm