Báo cáo khoa học: AtCYS1, a cystatin from Arabidopsis thaliana, suppresses hypersensitive cell death ppt

... Belenghi et al.(Eur. J. Biochem. 270) Ó FEBS 2003 AtCYS1, a cystatin from Arabidopsis thaliana , suppresses hypersensitive cell death Beatrice Belenghi 1, *, Filippo Acconcia 2, *, Maurizio Trovato 3 , ... concentrations. The NO-donor SNP was dissolved in water and used within 2 h. Cell death in Arabidopsis thaliana suspension cultured cells Cell death was assayed...

Ngày tải lên: 17/03/2014, 03:20

... pressure, and assume that learning takes place in an environment where simple semantic representations of the speech intent are available to the acquisition mechanism. For example, we approximate ... learning language " ;from a radio" and providing an unambiguous tex- tual transcription, as might be used for training a speech recognition system. Our goal is to create a...

Ngày tải lên: 08/03/2014, 07:20

... a 3 b 2 AnIB GGCCSHPACAANNQDYC a a 3 b 2 >> a 7 PnIA GCCSLPPCAANNPDYC a a 3 b 2 >> a 7 PnIB GCCSLPPCALSNPDYC a a 7 > a 3 b 2 EpI GCCSDPRCNMNNPDYC a a 3 b 4 , a 3 b 2 ; a 7 AuIA ... JM, ePlazas PV, Watkins M, Gomez-Casati ME, Olivera BM & Elgoyhen AB (2005) A novel alpha- conotoxin, PeIA, cloned from Conus pergrandis, discriminates between rat alpha9a...

Ngày tải lên: 16/03/2014, 11:20

... 20 Caceres A, Alvarez AV, Ovando AE & Samayoa BE (1991) Plants used in Guatemala for the treatment of respiratory diseases. 1. Screening of 68 plants against gram-positive bacteria. J Ethnopharmacol ... known as a tomatillo, is a staple of the Mesoamerican cuisine. In our laboratory, an ethyl acetate-soluble extract and four withanolides [ixocarpalactone A (IxoA), ixocarpalac- tone...

Ngày tải lên: 23/03/2014, 10:20

... facet. Finally, we train a machine learning classi- fier on training data and use it to classify unseen test examples, assigning a Table 1 label for each reference answer facet. We used a variety ... answer facets that are not ad- dressed at all by the student’s answer Table 1. Facet Annotation Labels 3 Automated Classification As partial validation of this knowledge representa-...

Ngày tải lên: 23/03/2014, 17:20

... construction of the poneratoxin gene [11]. Two oligonucleotides: forward 5¢- 2 GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GG...

Ngày tải lên: 30/03/2014, 13:20

... corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker Vera Sheinman The Japan Institute for Educational Measurement Inc. 3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004; Nagata et al., 2005; Nagata et al., 2006; Tetreault et al., 2010b). This is one of the most active research areas in natural language processin...

Ngày tải lên: 20/02/2014, 04:20

... derived from [Litman and Allen, 1987] as- sume that the dialogue speakers have access to the same domain plan library, and that the active domain plans are shared by the two speakers. We call ... understand- ing [Litman and Allen, 1987] assumes a single plan library that contains the domain plans of the two speak- ers, and a shared plan stack mechanism to track the current plan...

Ngày tải lên: 23/03/2014, 20:20

... this fam- ily are typically oxidases that are capable of performing a wide range of substrate (e.g. sugars and alcohols) oxidation reactions [48]. The flavogenome of the model plant A. thaliana is the ... janaschii, P. abyssi, Pl. falciparum, To. gondii, Sa. cerevisiae, N. crassa, A. thaliana, D. melanogaster and Homo sapiens. (B) The numbers of predicted flavoproteins as percentages of t...

Ngày tải lên: 28/03/2014, 22:21

... CO 2 availability. BMC Plant Biol 6, 15. 178 Hirashima M, Tanaka R & Tanaka A (2009) Light- independent cell death induced by accumulation of pheophorbide a in Arabidopsis thaliana. Plant Cell Physiol ... Przybyla et al. [34] later reported that irradiated flu plants produce large amounts of JA and OPDA and suggested that JA may be required for cell death propagation ⁄ mani...

Ngày tải lên: 16/03/2014, 02:20