Báo cáo khoa học: "Lexical Normalisation of Short Text Messages: Makn Sens a #twitter" pptx

... Linguistics Lexical Normalisation of Short Text Messages: Makn Sens a #twitter Bo Han and Timothy Baldwin NICTA Victoria Research Laboratory Department of Computer Science and Software Engineering The ... 145–148, Sapporo, Japan. Joseph Kaufmann and Jugal Kalita. 2010. Syntactic nor- malization of Twitter messages. In International Con- ference on Natural Language Processi...

Ngày tải lên: 17/03/2014, 00:20

... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin –1 . Name Sequence ssDNAS d(CATTCCCACCGGGACCACCAC) ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)...

Ngày tải lên: 15/02/2014, 01:20

... Reid GE, Karunarathne WK & Spence DM (2008) Metal-activated C-peptide facili- tates glucose clearance and the release of a nitric oxide stimulus via the GLUT1 transporter. Diabetologia 51, 175–182. 28 ... temperature of 25 °C on a Bruker Avance spectrometer equipped with a broad band inverse probe operating at a 1 H Larmor frequency of 400 MHz. Increasing amounts of SDS we...

Ngày tải lên: 18/02/2014, 04:20

... that diffuses out of the nuclei after micrococcal nuclease (MNase) digestion is in the 30 nm fibre conformation. It consists of a regular helix with a diameter of approximately 33 nm and a variable mass ... octa- and nonanucleosomes and half the amount of hexa- and decanucleosomes (6- to 10-mer sample). (A) (a) Nonamer of a sequential single helix. (b, c) Sedimentation profil...

Ngày tải lên: 18/02/2014, 18:20

... case of Tm– F-actin complexes, the final concentration of F-actin was 46 lm. F-actin was stabilized by the addition of a 1.5-fold molar excess of phalloidin (Sigma) to obtain a better separ- ation ... muscle a- Tm was shown to increase the actin affinity of a- Tm [5], and the same exon exchange has a similar effect between fibroblast Tm 5a and 5b isoforms [6]. This replacement...

Ngày tải lên: 19/02/2014, 07:20

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435, Sydney, July 2006. c 2006 Association for Computational Linguistics 428 0.5 1 1.5 ... 4 5 6 7 8 entropy offset 429 430 431 432 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1 recall precision Bincrease Bordinary Bmax 433 0 0.1 0.2 ... 1 recall precision...

Ngày tải lên: 20/02/2014, 12:20

... and Lang [1992] we use grammars as a means of recording all parses. Billot and Lang used context-free gram- mars (cfg) for representing all parses in a cfg parser demonstrating that a shared ... adjoining (SA) constraint that determines the set of auxiliary trees that can be adjoined at that node. In addition when adjunction is mandatory at a node it is said to have an obli...

Ngày tải lên: 22/02/2014, 10:20

... University of Arizona Experiment Station Funds, and American Cancer Society Faculty Research Award #FRA-420 to E. V. G. J. L. was a recipient of a National Institutes of Health Postdoctoral Fellowship. ... molecular chaperone activity [1]. sHsps are defined by a conserved C-terminal domain of  90 amino acids, called the a- crystallin domain, which is flanked by a short C-ter...

Ngày tải lên: 07/03/2014, 15:20

... Arguments: Detection and Evaluation Sophia Katrenko Institute of Informatics University of Amsterdam the Netherlands katrenko@science.uva.nl Pieter Adriaans Institute of Informatics University of Amsterdam the ... one starting state and a separate sequence of states for each positive exam- ple and then uses a merging strategy such that no negative examples are accepted. Similarl...

Ngày tải lên: 08/03/2014, 01:20

... Tagged Data Set, manually pro- duced by Rada Mihalcea and Li Yang (Mihalcea, 2003), from text drawn from the British National Corpus. We calculated a ‘supervised’ baseline from the annotated data by ... Topic signatures can be useful in a number of Natural Language Process- ing (NLP) applications, such as Word Sense Disambiguation (WSD) and Text Summarisation. Our method takes ad- v...

Ngày tải lên: 08/03/2014, 04:22