Báo cáo khoa học: "Structural Semantic Relatedness: A Knowledge-Based Method to Named Entity Disambiguation" potx
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaeal triosephosphate isomerase adapted to high temperature. J Mol Biol 342, 861–875. 12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S, Balaram H, Balaram ... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H,...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot
... Jun-Ho Chae 2 , Naoshi Dohmae 1 , Bok Luel Lee 2 and Hiroshi Nakayama 1 1 Biomolecular Characterization Team, RIKEN Advanced Science Institute, Saitama, Japan 2 National Research Laboratory of ... acyl–enzyme intermediate. Biochemistry 49, 341–346. 3 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for Lol-depe...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... the Na + -translocating F-ATP synthase from I. tartaricus seems to be particularly suitable for structural investi- gations. For a more detailed characterization of this system, and to increase experimental ... primers: Structural evidence for a constant c 11 ring stoichiometry T. Meier et al. 5480 FEBS Journal 272 (2005) 5474–5483 ª 2005 FEBS 5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward),...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... to encode a sialyltransferase that adds Neu5Ac in an a- 2,3- linkage to lactose in other H. influenzae strains, is present in strain 981 (data not shown). Sialyllactose is known to contribute to the ... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relative abundance was estimated from the area of molecular ion peak relative to the total area (express...
Ngày tải lên: 08/03/2014, 02:21
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... the top-down approach deserve consideration for important pro- teomics research. Acknowledgements We thank Barbara Baird, Ian Jardine, Neil Kelleher, Harold Scheraga and Klaas van Wyck for valuable discussions, ... these fragment mass values originate from the same molecular ions, so they must all be characteristic of that protein’s sequence and molecular mass value. Thus, top-down data can g...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... FEBS Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 Department ... UMP kinases from gram-negative and gram-positive bacteria. J Biol Chem 282, 7242–7253. 18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin A& amp;Baˆ rzu O (1998) Mutational...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr D 55, ....
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... Kpn1 and Nco1 sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization ... oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3¢ (reverse). Virus amplification was performed in monolayer SF21 cells, and protein e...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... that all PAS-annotated A. thaliana proteins also contain a PAC motif, and conversely that all PAC- annotated A. thaliana proteins contain a PAS domain. Therefore, in the case of A. thaliana,thePASandPAC motifs ... R674–R677. 4.Kasahara,M.,Swartz,T.E.,Olney,M .A. ,Onodera ,A. , Mochizuki,N.,Fukuzawa,H.,Asamizu,E.,Tabata,S.,Kanegae, H., Takano, M., Christie, J.M., Nagatani, A. & Bri...
Ngày tải lên: 19/02/2014, 12:20