Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc

Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc

Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc

... chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain Wojciech Majeran 1 , Giulia Friso 2 , Klaas Jan van Wijk 2 and Olivier Vallon 1 1 ... Cyanobacteria [22] and in the genome of the Cyanophora cyanelle, an ancestral chloroplast. In the green alga Chlamydomonas reinh...

Ngày tải lên: 16/03/2014, 23:20

14 436 0
Tài liệu Báo cáo khoa học: The calcium-induced switch in the troponin complex probed by fluorescent mutants of troponin I doc

Tài liệu Báo cáo khoa học: The calcium-induced switch in the troponin complex probed by fluorescent mutants of troponin I doc

... isolated TnC are well known. Sites III and IV in the C -domain (carboxy terminal) bind Ca 2+ with higher affinity, while sites I and II in the N -domain (amino terminal) bind Ca 2+ with lower affinity ... are sensitive to Ca 2+ binding to the two classes of sites, and the authors interpreted the high affinity sites being in the C -domain and the low affinity in the...

Ngày tải lên: 20/02/2014, 11:20

8 504 0
Tài liệu Báo cáo khoa học: The occurrence of hemocyanin in Hexapoda docx

Tài liệu Báo cáo khoa học: The occurrence of hemocyanin in Hexapoda docx

... 23 crustacean hemocyanins, 4 crustacean pseudohemocyanins, 20 chelicerate hemocyanins, 5 myriapod hemocyanins and 1 onychophoran hemocyanin in the final alignment, which was manually adjusted with the aid ... BduHc2 Periplaneta americana Blattaria Blattidae Juvenile, adult PamHc1 PamHc2 Shelfordella lateralis Blattaria Blattidae Juvenile, adult SlaHc1 SlaHc2 Graphosoma lineatum Hemipte...

Ngày tải lên: 18/02/2014, 08:20

12 648 0
Tài liệu Báo cáo khoa học: The sequentiallity of nucleosomes in the 30 nm chromatin fibre pptx

Tài liệu Báo cáo khoa học: The sequentiallity of nucleosomes in the 30 nm chromatin fibre pptx

... similar abundances and can be assessed quantitatively) in the dinucleosome sample is indistinguishable from that of high- molecular weight chromatin. Furthermore, in the DNase I foot- print of the ... that approximately 90% of the DNA in the main peak as well as the mononucleo- somes and band S are all in the 140–160 bp size interval (not shown). The high percenta...

Ngày tải lên: 18/02/2014, 18:20

11 652 0
Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus influenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt

Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus influenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt

... CYLD in air- way epithelial A5 49 and NHBE cells in vitro and in vivo. As shown in Fig. 5A, B, NTHi up-regulated CYLD in A5 49 and NHBE cells as well as in the lungs of mice intratracheally inoculated ... 4 signaling pathway acts as a positive regulator for TLR2 induction by bacteria via a dual mechanism involving functional cooperation with NF-kappaB and MAPK phosphatas...

Ngày tải lên: 19/02/2014, 00:20

14 366 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

... osmoregulation and sporulation. Isola- tion and characterization of yeast mutants blocked at various sta- ges of transport pathways are an invaluable method for unravelling the molecular details of vacuolar ... binding of apoE. (iii) ABCA1, syntaxin-13 and flotillin-1 operate in both loading conditions with different response rates and downstream signalling involving an inward rect...

Ngày tải lên: 19/02/2014, 07:20

7 749 0
Tài liệu Báo cáo khoa học: "The Nature of Affixing in Written English" docx

Tài liệu Báo cáo khoa học: "The Nature of Affixing in Written English" docx

... formulate an operational defini- tion of 'affix'. The words in Class II, typified by REPLACE, have the property that the internal-consonant string is an ad- missible initial-consonant ... examine the Class IV words. The Class IV words are distinguished by the property that the internal consonant string is neither an admis- sible initial- nor an admis...

Ngày tải lên: 19/02/2014, 19:20

6 602 0
Tài liệu Báo cáo khoa học: "The Role Of Focussing in Interpretation of Pronouns " pdf

Tài liệu Báo cáo khoa học: "The Role Of Focussing in Interpretation of Pronouns " pdf

... choice rather than by search ~lsing general inference. The paper also indicates what additional requirements are needed for a full treatment of pronominal anphora. These include use of a representation ... research done at the Artificial Intelligence Laboratory of the Massachusetts Institute of Technology. Support for the laboratory's artificial intelligence research i...

Ngày tải lên: 21/02/2014, 20:20

2 514 0
Tài liệu Báo cáo khoa học: "The Role of Initiative in Tutorial Dialogue" pdf

Tài liệu Báo cáo khoa học: "The Role of Initiative in Tutorial Dialogue" pdf

... of the authors of the pa- per and another human annotator (not a project member) corrected the automatic annotations. The annotators had a reference manual and trained on trial sessions of the ... dialogues. To test inter- annotator reliability, the author and external anno- tator labeled the same 757 examples taken from non-training data; the resulting inter-annotator re-...

Ngày tải lên: 22/02/2014, 02:20

8 629 0
Báo cáo khoa học: The product chain length determination mechanism of type II geranylgeranyl diphosphate synthase requires subunit interaction pptx

Báo cáo khoa học: The product chain length determination mechanism of type II geranylgeranyl diphosphate synthase requires subunit interaction pptx

... ananatis, as the template, the crtE gene encoding GGPS was amplified using PCR with KOD DNA polymerase (Toyobo, Osaka, Japan) and the primers: PaG GPS-Fw, 5¢-AAGAAA CATATGACGGTCTGCGCAAA AAAACACG-3¢, ... such as geranyl diphosphate synthase (GPS) and longer-chain prenyl diphosphate synthases. Results Refolding and purification of recombinant P. ananatis GGPS P. ananatis GGPS and the mu...

Ngày tải lên: 07/03/2014, 06:20

13 355 0
w