Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

... Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ Takayasu Kawasaki 1 , Mudeppa D. Gouda 1 , Tatsuya Sawasaki 1,2 , Kazuyuki Takai 1,2 and ... 5¢- CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circulari...

Ngày tải lên: 16/03/2014, 23:20

... participates in growth regulation of human breast carcinoma cells. Oncogene 20, 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y ... (2006) Stattic: a small-molecule inhibitor of STAT3 activation and dimerization. Chem Biol 13, 1235–1242. 30 Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V, Cao A, Cymbalista F, Bogd...

Ngày tải lên: 18/02/2014, 08:20

... toward cleavage of the GUC 665 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTGCCCTGCCCCCTGATGAGGCCGA AAGGCCGAAACTTGCCCCTGGTACCCCGGATAT CTTTTTTTCTATCGCGTCGACCT-3¢ and the template encoding ... (targeted toward CUC 825 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTCACCCTTCCGCTGATGAGGCCGA AAGGCCGAAAGGTCCCGGTGGTACCCCGGATA TCTTTTTTTCTATCGCGTCGACCT-3¢. The ribozyme...

Ngày tải lên: 08/03/2014, 08:20

... feature templates. A template of part -of- speech tag features was added for CoNLL00, CoNLL03, and Encyclopedia. In particu- lar, all tasks except PTB and NetTalk require assigning a label to a ... which CRFs efficiently learn and predict large-scale natural language data. 2 Linear-chain CRFs Many versions of CRFs have been developed for use in natural language processing, computer v...

Ngày tải lên: 23/03/2014, 17:20

... clipping of a fragment of desired length and sequence from a nat- ural RNA may be a useful application. For example, RNA fragments that involve modified nucleobases are easily obtainable from naturally ... Chemical synthesis of an artificially branched hairpin ribozyme variant with RNA cleavage activity. Tetrahedron 60, 9273–9281. 29 Komatsu Y, Kanzaki I, Koizumi M & Ohtsu...

Ngày tải lên: 20/02/2014, 01:20

... J Natl Cancer Inst 100, 109–120. 77 Minakuchi Y, Takeshita F, Kosaka N, Sasaki H, Yamamoto Y, Kouno M, Honma K, Nagahara S, Hanai K, Sano A et al. (2004) Atelocollagen-mediated synthetic small ... prostate-specific membrane anti- gen [56]. A key advantage of aptamer-mediated targeted delivery systems is that RNA aptamers can be facilely obtained by in vitro transcription reaction and, th...

Ngày tải lên: 06/03/2014, 01:23

... of ine composition strategies to application of cascades of tree transducers. Tables 2a and 2b summa- rize the available methods of forward and back- ward application of cascades for recognizability- preserving ... on real data. We thus demonstrate bucket-brigade and on-the-fly backward applica- tion on a typical NLP task cast as a cascade of wLNT. We adapt the Japanese-to-Engl...

Ngày tải lên: 17/03/2014, 00:20

... Kinosita and Yoshida Laboratories for help and advice, and S. Takahashi and K. Sakamaki for encour- agement and laboratory management. This work was supported in part by a Grants-in-Aid for Specially Promoted ... examined how substrate concentrations affect the rate of ATP synthesis. The ADP concentra- tion was changed from 1 lm to 1 mm at a saturating concentration (10 mm)ofP i (Fig...

Ngày tải lên: 22/03/2014, 16:20

... contrast, what is needed by the approximation in Equation (1) is to iden- tify all paths containing an n-gram and accumulate their probabilities. The accumulation of probabil- ities at the path ... (3) The approximation replaces the sum over all paths in the lattice by a sum over lattice n-grams. Even though a lattice may have many n-grams, it is possible to extract and enumerate them e...

Ngày tải lên: 23/03/2014, 16:20

... which may be an advantage in some applications. The Russian evaluation posed a bit of a prob- lem because the Russian WordNet is not readily available and its coverage is rather small. Fortu- nately, ... lexical category acquisition. We use two main stages: discovery of pattern candidates, and identification of the symmetric patterns among the candidates. 3.1 Pattern Candidates An ex...

Ngày tải lên: 23/03/2014, 18:20