Báo cáo khoa học: Characterization of Met95 mutants of a heme-regulated phosphodiesterase from Escherichia coli ppt

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢,5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢,5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and ... Hirata S, Matsui T, Sasakura Y, Sugiyama S, Yoshim- ura T, Sagami I & Shimizu T (2003) Characterization of Met95 mutants of a heme-regulated phosphodiesterase from Escherich...

Ngày tải lên: 16/03/2014, 13:20

14 390 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig. 1C). ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAAT...

Ngày tải lên: 21/02/2014, 03:20

11 507 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... post-treatment. The poly (A) -RNA was extracted from the larvae, and 300 ng mRNA of each sample was loaded on a gel. Actin mRNA served as an internal marker to equate mRNA quantities. Fig. 9. Alignment ... DIG Labelling Mix (Roche). To prepare a DmEH probe, primers (5¢-ATGGCGAAC ATCTGGCCACGAATC-3¢ and 5¢-TTATGAGAAATT GGCTTTCTGGAC-3¢) were used, and to prepare Actin 5C probe as an inte...

Ngày tải lên: 07/03/2014, 21:20

10 379 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... hydrolases and share structural and functional characteristics, including a catalytic triad, an a ⁄ b- hydrolase fold and a cofactor independent activity. The catalytic triad usually consists of a ... et al. 2838 FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAA...

Ngày tải lên: 23/03/2014, 09:20

11 461 0
Báo cáo khoa học: Characterization and synthetic applications of recombinant AtNIT1 from Arabidopsis thaliana doc

Báo cáo khoa học: Characterization and synthetic applications of recombinant AtNIT1 from Arabidopsis thaliana doc

... Characterization and synthetic applications of recombinant AtNIT1 from Arabidopsis thaliana Steffen Osswald, 1 Harald Wajant 2 and Franz Effenberger 1 1 Institut fu È r Organische Chemie, and 2 Institut ... SDS /PAGE a nd stain ed with Coo massie . Last lane, molecular masses of standards (kDa); lanes 17±19, active fractions after HiTrap chromatography. (C) E stimation of native m...

Ngày tải lên: 23/03/2014, 21:21

8 425 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... 1792AF AAAAAGCAGGCTTGCTGTTCTAAGTGTACTAGCTGGA b ) 1792pA::GUS ) 1263AF AAAAAGCAGGCTCAAATTAAATCGACGGTTGAG b ) 1263pA::GUS ) 764AF AAAAAGCAGGCTCAATGTAGTACCAATTGGGGTACC b ) 764pA::GUS ) 234AF AAAAAGCAGGCTGAGAAATCTATGGAATAAATAAAAATTAGGG b ) ... CB-3¢ ActF GATATGGAAAAGATCTGGCATCAC RT-PCR (Atactin 2) ActR TCATACTCGGCCTTGGAGATCC RT-PCR (Atactin 2) ) 2912AF AAAAAGCAGGCTATGAATTGCTAGAGTTGGTTAATGC b ) 29...

Ngày tải lên: 30/03/2014, 09:20

17 360 0
Báo cáo khoa học: "Toolkit for Multi-Level Alignment and Information Extraction from Comparable Corpora" pptx

Báo cáo khoa học: "Toolkit for Multi-Level Alignment and Information Extraction from Comparable Corpora" pptx

... the ACCURAT toolkit 1 - a collection of tools that are capable of analysing comparable corpora and extracting parallel data which can be used to improve the performance of statistical and ... such as daily news articles and large knowledge bases like Wikipedia, are much more widely available than parallel translation data. While methods for the use of parallel corpora in m...

Ngày tải lên: 16/03/2014, 20:20

6 289 0
Báo cáo khoa học: "Towards an Adaptive Communication Aid with Text Input from Ambiguous Keyboards" pptx

Báo cáo khoa học: "Towards an Adaptive Communication Aid with Text Input from Ambiguous Keyboards" pptx

... telecommunication (although fast exchange via SMS or e–mail some- times develops into a synchronous communication situation). Alternative and augmentative (AAC) methods typically deal with communication strate- gies ... to the space bar is pressed, a dictionary is consulted to find all words corresponding to the ambiguous code. The advantages of an ambiguous keyboard with word disambigu...

Ngày tải lên: 17/03/2014, 22:20

4 269 0
Báo cáo khoa học: Characterization of Met95 mutants of a heme-regulated phosphodiesterase from Escherichia coli ppt

Báo cáo khoa học: Characterization of Met95 mutants of a heme-regulated phosphodiesterase from Escherichia coli ppt

... the Met95Ala and Met95Leu mutants. It is possible that an unknown ligand, such as water/hydroxylate anion (or an amino-acid main chain), coordinates to the Fe(III) in Met95Ala and Met95Leu mutants ... 23821–23827. 2. Sato, A. , Sasakura, Y., Sugiyama, S., Sagami, I., Shimizu, T., Mizutani, Y. & Kitagawa, T. (2002) Stationary and time-resolved resonance Raman spectra of His77 and Me...

Ngày tải lên: 16/03/2014, 23:20

9 355 0
Báo cáo khoa học: Characterization of rat cathepsin E and mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells ppt

Báo cáo khoa học: Characterization of rat cathepsin E and mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells ppt

... Fukuoka, Japan 2 Department of Oral Molecular Pharmacology, Graduate School of Biomedical Sciences, Nagasaki University, Japan Cathepsin E (EC 3.4.23.24) is an intracellular aspartic proteinase of ... Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster...

Ngày tải lên: 16/03/2014, 14:20

11 278 0
w