Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc
... 47, 2725–2731. Novel cytochrome < /b> b mutation in human and yeast E. L. Blakely et al. 3592 FEBS Journal 272 (2005) 3583–3592 ª 2005 FEBS A < /b> mitochondrial < /b> cytochrome < /b> b mutation causing severe respiratory chain enzyme ... the abundance and segregation of the causative mutation, the gene that is mutated and the associated biochemical defect;...
Ngày tải lên: 16/03/2014, 22:20
... an aminoacidoranamino-alcohol[11].Incontrast,MAAsare UV absorbing metabolites of algae that contain an amino- cyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm. To date, ... damage before it can be incorporated permanently into the genome. Typically, DNA damage is repaired at a < /b> relative high rate in human cells by various repair mechanisms including phot...
Ngày tải lên: 07/03/2014, 15:20
... the (1fi3) -b- D -glucan-binding protein was identified biochem- ically. The binding of the linear carbohydrate, curdlan, was abolished by the branched molecule, laminarin, indicating that in S. domuncula ... fibrinogen a/< /b> a-E chain precursors from chicken (FIBA_CHICK; P14448), human (FIBA_HUMAN; P02671) and rat fibrinogen (FIBA_RAT; P06399), and the fibrinogen c -B chain precurs...
Ngày tải lên: 16/03/2014, 16:20
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt
... tachykinins: a < /b> review. Zool Sci 5, 533–549. 7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy- ama M, Minakata H, Chiba T, Metoki H, Satou Y & Satoh N (2004) Tachykinin and tachykinin receptor ... Aoyama and Honoo Satake Suntory Institute for Bioorganic Research, Osaka, Japan Tachykinins (TKs) are vertebrate multifunctional brain ⁄ gut peptides involved in various central and...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx
... sorting of proteins to the vacuole in Saccharomyces cerevisiae. J Biol Chem 267, 3416–3422. 62 Ban N, Matsumura Y, Sakai H, Takanezawa Y, Sasaki M, Arai H & Inagaki N (2007) ABCA3 as a < /b> lipid ... vacuole morphology ⁄ appearance within larval intestinal cells. These data show that increased osmo- larity can rapidly and substantially reduce the number of vacuoles in umps-1(zu456...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... software package (Invitro- gen). Amino acid numbering and cysteine positions are used in accordance with the standard numbering for PLA 2 s introduced by Renetseder et al. [28]. A < /b> blast search ... lm, respectively. Data mining and phylogenetic analysis All database searches were performed online and were com- pleted in January 2009. The databases analyzed were the nonredundan...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: A role of monocyte chemoattractant protein-4 (MCP-4)/CCL13 from chondrocytes in rheumatoid arthritis doc
... D, Shimbara A,< /b> Luster A,< /b> Hogg JC & Hamid QA (1999) Eotaxin and mono- cyte chemotactic protein-4 mRNA expression in small airways of asthmatic and nonasthmatic individuals. J Allergy Clin Immunol ... Y, Singh G, Yamanaka H, Tanaka E, Urano W, Taniguchi A,< /b> Saito T, Hara M, Tomatsu T & Kamatani N (2003) Validation of a < /b> Japanese version of the Stanford Heal...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... pKT25 kan .The DNA fragments encoding tentative middle domain and C-terminal one of human GRP94 were amplified by PCR andtheninsertedinanXbaI/BamHI site of both pUT18C amp and pKT25 kan . The DNA fragment ... T., Kobayakawa, T., Tanaka, E., Baba, T.T., Tanaka, K., Takagi, T. & Gotoh, T. (2001) Domain–domain interactions of HtpG, an Esherichia coli homologue of eukaryotic HSP90 molecula...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
... fixed and double-stained with polyclonal antip35 (C-19) and anti-AT8 Ig (a,< /b> c, and e) and with polyclonal antip35 (N-20) and anti-AT8 Ig (b, d, and f). a < /b> and b expressed transfected p25 and p35, ... Tarricone et al. [21]. The sequences comprising p25, p16 and CIP are indicated by the labelled arrows. (B) A < /b> combination of N-terminal and C-terminal trunc...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
... 5¢-GCGCAAGCGCTTACG ACTTAAAAAAATTGGTCAGAAAATCCAGG-3¢; 2.5T antisense primer, 5¢-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3¢; 2.5I sense primer, 5¢-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3¢; ... 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGC...
Ngày tải lên: 30/03/2014, 04:20