... buffer were obtained from Fermentas
(St Leon-Rot, Germany).
RNA preparation
The sequence of primer P1 (promoter primer) is 5¢-TAATA
CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and
that of primer P2 (reverse ... world’
or in an early stage of the development of life, when
small RNA would have played a major role. Popula-
tions of small RNA could have interacted randomly
with small metaboli...
... 2002) or
(AbdulJaleel and Larkey, 2003) require a large set of
sample transliterations to use for training. If such a
training set is unavailable for a particular language
pair, a detection algorithm ... transliterations of the units are assessed
manually from a set of training pairs. For each
katakana string in a bitext, all possible translitera-
tions are produced based...
... in both
answers, and AllIds is the number of different ids
in both answers. We calculated the overall average
agreement ratio (Total Avg) and the average of the
best matches between two assignments ... human evaluation (Lin and Hovy,
2003).
Overlaps of higher order N-grams are more usable
within speech summarisation as they take the gram-
matical structure and fluency of the su...
... were analyzed manually
and automatically by
SEQUEST
software. The acquisition
and deconvolution of data were performed with the
XCALI-
BUR
software on a Windows NT PC data system.
Determination of ... obtained from data bank and the abbreviations stand for: AaH, Androctonus australis
Hector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occitanus tunet...
... patterns of agree-
ment and disagreement (Hawes et al., 2009; Abbott
et al., 2011), and relationships among conversational
participants (Ireland et al., 2011).
One of the most natural ways to capture ... al.,
2010) and tools that summarize (Murray et al., 2005)
and display (Ehlen et al., 2007) conversational data.
Topic segmentation also can illuminate individuals’
agendas (Boydst...
... classifica-
tions. The baseline is calculated, for each task, as
the average value of the Adjusted Rand measure for
100 random cluster assignations. Although all the
tasks perform better than the baseline, ... value of all the data
points, in order to get an indication of the overall
quality of the clusters created. The main difficulty in
evaluating unsupervised classification tasks agai...
... we add
two NLP-oriented features, as described below: a
statistical language model and a measure of tense
difficulty.
4.1 The language model
The lexical difficulty of a text is quite an elaborate
phenomenon ... investigation.
This research is still in progress, and further
analyses are planned. The predictive capacity of
some other lexical and grammatical features will...
... Ala
L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala
2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn
3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala
G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala
F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala
3K > Q K37Q F g...
... Evaluation of
Association Measures
2.1 State -of- the-art
A standard procedure for the evaluation of AMs is
manual judgment of the -best candidates identi-
fied in a particular corpus by the measure ... among
low-frequency data.
(2) The evaluation strategies applied: Instead
of examining only a small sample of
-best can-
didates for each measure as it is common practice,
we mak...
... Subbuswamy K. Prabu
1,
*, Cynthia M. Otto
2
and Narayan G. Avadhani
1
1
Department of Animal Biology and
2
Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania,
Philadelphia, ... with Apo-ferritin and
b-amylase. Based on the rates of migration, the slow
migrating complex may be a dimmer and the faster
migrating complex migrating with an...