Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx
Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx
... buffer were obtained from Fermentas (St Leon-Rot, Germany). RNA preparation The sequence of primer P1 (promoter primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and that of primer P2 (reverse ... world’ or in an early stage of the development of life, when small RNA would have played a major role. Popula- tions of small RNA could have interacted randomly with small metaboli...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: "Bootstrapping a Stochastic Transducer for Arabic-English Transliteration Extraction" pdf
... 2002) or (AbdulJaleel and Larkey, 2003) require a large set of sample transliterations to use for training. If such a training set is unavailable for a particular language pair, a detection algorithm ... transliterations of the units are assessed manually from a set of training pairs. For each katakana string in a bitext, all possible translitera- tions are produced based...
Ngày tải lên: 08/03/2014, 02:21
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... in both answers, and AllIds is the number of different ids in both answers. We calculated the overall average agreement ratio (Total Avg) and the average of the best matches between two assignments ... human evaluation (Lin and Hovy, 2003). Overlaps of higher order N-grams are more usable within speech summarisation as they take the gram- matical structure and fluency of the su...
Ngày tải lên: 20/02/2014, 09:20
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... were analyzed manually and automatically by SEQUEST software. The acquisition and deconvolution of data were performed with the XCALI- BUR software on a Windows NT PC data system. Determination of ... obtained from data bank and the abbreviations stand for: AaH, Androctonus australis Hector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occitanus tunet...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx
... patterns of agree- ment and disagreement (Hawes et al., 2009; Abbott et al., 2011), and relationships among conversational participants (Ireland et al., 2011). One of the most natural ways to capture ... al., 2010) and tools that summarize (Murray et al., 2005) and display (Ehlen et al., 2007) conversational data. Topic segmentation also can illuminate individuals’ agendas (Boydst...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc
... classifica- tions. The baseline is calculated, for each task, as the average value of the Adjusted Rand measure for 100 random cluster assignations. Although all the tasks perform better than the baseline, ... value of all the data points, in order to get an indication of the overall quality of the clusters created. The main difficulty in evaluating unsupervised classification tasks agai...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx
... we add two NLP-oriented features, as described below: a statistical language model and a measure of tense difficulty. 4.1 The language model The lexical difficulty of a text is quite an elaborate phenomenon ... investigation. This research is still in progress, and further analyses are planned. The predictive capacity of some other lexical and grammatical features will...
Ngày tải lên: 08/03/2014, 21:20
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn 3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala 3K > Q K37Q F g...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc
... Evaluation of Association Measures 2.1 State -of- the-art A standard procedure for the evaluation of AMs is manual judgment of the -best candidates identi- fied in a particular corpus by the measure ... among low-frequency data. (2) The evaluation strategies applied: Instead of examining only a small sample of -best can- didates for each measure as it is common practice, we mak...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... Subbuswamy K. Prabu 1, *, Cynthia M. Otto 2 and Narayan G. Avadhani 1 1 Department of Animal Biology and 2 Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, ... with Apo-ferritin and b-amylase. Based on the rates of migration, the slow migrating complex may be a dimmer and the faster migrating complex migrating with an...
Ngày tải lên: 20/02/2014, 23:20