Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified PCR product was inserted into the ... oxidase, Japanese patent 61115488. 37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent 60062980. 38 Abdel-Raheem A & She...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... (Ga- napathibhotla and Liu, 2008). Our annotation scheme stands on the following assumptions: (i) the sentence is the unit of analysis, whose interpretation may require the analysis of the ... states were manually annotated. The annotation was per- formed at word and phrase level, and the sentiment expressions identified in the corpus were asso- ciated to the...

Ngày tải lên: 20/02/2014, 05:20

5 499 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially useful in agriculture and medicine because of their antiviral properties ... RIP named pulchellin. It exhibits specificity for galactose and galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the micro...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ ... (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse) 75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... follows: HSF 1a forward, 5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢; HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACAC CTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGC CAGTAGC-3¢; ... Plasmid Cloning kit (Invitrogen) and was used as the PCR template. For 5¢-RACE, the first PCR was performed with the M13 reverse primer (5¢-AGCGGATAACAATTTCACACAGG-3¢)asa sense prim...

Ngày tải lên: 19/02/2014, 12:20

10 539 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl ... h. The amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-Chrom Ò ; Merck-Hitachi, Darmstadt, Germany) with a diode array...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... were plated again on 1 lm paraquat agar plates, so as to obtain approximately 500 colonies per plate. After incubation of these replated mutant colonies at 37 °C for another 20–24 h, the average ... However, the backbone amide and carbonyl of Cys140 form hydro- gen bonds with the backbone carbonyl and amide of Trp123, the side chain of which forms one wall of the activ...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoI ML3p A- chain 5¢- GATATA CATATG TACCGTCGTATTAGCCTTCGTGTCACGGAT -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI and EcoRI ML3.1p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI ... and XhoI ML2p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC CTCGAG TTATTAAGAAGA...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... 5¢-gcgccaatcctggacgctgacgtcatcgacgcg-3¢ (forward) and 5¢-cgcgtcgatgacgtcagcgtccaggattggcgc-3¢ (reverse). The bases in bold indicate the location of the mutation. DNA sequence of the mutant was confirmed ... strands associated to an anti- parallel strand (b2) and is surrounded by 5 helices (a1 , a2 , a3 , a7 anda8). T he second domain c onsists of helices a4 , a5 and a...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a strict anaer- obe. While the best known small ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hypertherm...

Ngày tải lên: 07/03/2014, 17:20

12 420 0
w