Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Journal 272 (2005) 1291–1304 ª 2005 FEBS Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and ... value, and safety of d-amino acids. Adv Exp Med Biol 289, 447–481.39 Lohmann KN, Gan S, John MC & Amasino RM(1994) Molecular analysis of natural leaf senescence in Arabidopsis thaliana. ... have a molecular mass of 41.7 kDa and a pI of 6.34.The YedO protein from E. coli and the d-CDes from Arabidopsis showed an overall identity of 36% and a similarity of 50%. The blastp program in...

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... MareÂchal, P.,Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein in Escherichia ... Storz, G. &Rhee, S.G. (1994) Cloning and sequencing of thiol-speci®cantioxidant from m ammalian brain: alkyl reductases and thiol-speci®c antioxidant de®ne a large family o f antioxidant enzymes.Proc. ... thioredoxin-dependentperoxidase from Chlamydomonas reinhardtiiAymeric Goyer1, Camilla HaslekaÊs2, Myroslawa Miginiac-Maslow1, Uwe Klein2, Pierre Le Marechal3,Jean-Pierre Jacquot4 and Paulette Decottignies31Institut...

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts3 and Ana Paula U. Arau´jo1,21 Programa de Po´s-graduac a o em Gene´tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil2 Instituto de Fı´sica de Sa˜o Carlos, Universidade ... Prop-erties of volkensin, a toxic lectin from Adenia volkensii.J Biol Chem 260, 14589–14595.10 Ramos MV, Mota DM, Teixeira CR, Cavada BS &Moreira RA (1998) Isolation and partial characterisa-tion...

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain speciﬁc for the human mitochondrial translocase receptor Tom70 potx

... (Forward: 5¢-ACAAGGGTAGACCAAACACCAAGAACAGCAACAAAAGAGACGGGCGAATCACTGACCATCAACgccGTCCTGAGAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAATGCGGTGCCAGCTCCCCAACTGTAATAAATACCAGACAAATTATATGCTCCaacCCTATACGTGCCACTG-3¢); ... of two protein chains, each containingone variable and ﬁve constant domains, and functions as anantibody. In order to assess the antigen-binding capabilities of isolated IgNAR variable domains ... TRVDQTP…5¢ Ampliﬁcation 8407 (ﬁ)GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC N-terminus ¼ ARVDQTP…5¢ Ampliﬁcation 8408 (ﬁ)GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC N-terminus ¼ AWVDQTP…3¢ Ampliﬁcation...

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... temperature (1 h). Sequences of the upper strand of the duplexes are listed below.Sites of mutation are underlined: wt, 5¢-AGAGAGAATGAGAGGCTTCCCAATAGC-3¢;mut1,5¢-AGAGAGAATGATAGGCTTCACAATAGC-3¢;mut2,5¢-AGAGAGAATGATAGGCTTCCCAATAGC-3¢;mut3,5¢-AGAGAGAATGAGAGGCTTCACAATAGC-3¢.Binding ... XHIVEP1,5¢-ATCCAGAGGCAGAAGCAG-3¢ and 5¢-CTGCATTCAGAGTAAGCC-3¢,60°C, 29 cycles; XHIVEP2,5¢-AAGCAGAGGAATGCAGTAG-3¢ and 5¢-AATGTCTTTCTCTCCATGG-3¢,60°C, 29 cycles; XHIVEP3,5¢-GCAGCACTATCCCTGCTAAG-3¢ and 5¢-TCCCTCGTCCACGGCCTCTTACAT-3¢,60°C, ... ampliﬁcation(5¢-GARAAYTTYGARAAYCAYAARAARTTYTAYTG-3¢ and 5¢-AGTTCTAATGCTATGTTTGGATGC-3¢)affor-ded a product of 1.7 kb. Additional screening of a XenopuscDNA phage library with primers derived from XHIVEP1(5¢-TACTGGGGCATTAGAACAACCTT-3¢...

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... fungaltyrosinases, from both a structural and a functionalpoint of view, are from Agaricus bisporus [10] and N. crassa [1]. Also, a few bacterial tyrosinases havebeen reported, of which Streptomyces tyrosinases ... tyro-sinases from N. crassa [26–28] and Agaricus [28] and Pycnoporus species [25] have an additional C-terminaldomain that is proteolytically released from the cata-lytic domain. It has been ... 8981–8990.18 Margolles-Clarck E, Tenkanen M, Nakari-Seta¨la¨T&Penttila¨M (1996) Cloning of genes encoding alpha-L-arabinofuranosidase and beta-xylosidase from Tricho-derma reesei by...

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... reverse)35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward)25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate ... component of the nucleolus and sti-mulated by phosphorylation with CK2 and cdc2 protein kinases. Plant J 25, 9–17.32 Yadav N, Chandok MR, Prasad J, Bhattacharya S,Sopory SK & Bhattacharya A (1997)...

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

... inves-tigation because of their physiological importance and their pharmaceutical relevance as drug carriers [1–6].Both transporters catalyse the uptake of most dipep-tides and tripeptides and a variety ... was inhibited not only byunlabeled Bip-Pro itself, but also by well known sub-strates of H+⁄ peptide cotransporters, such as Gly-Sar,Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,d-aminolevulinic ... amount of Bip-Pro in the extracellular uptake mediumwas quantiﬁed according to the laboratory standard HPLC(La-ChromÒ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and a...

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulﬁde reductase from Pyrococcus horikoshii Implications for the disulﬁde metabolism of anaerobic hyperthermophiles doc

... act as an NADH oxidase in vivo, instead act-ing as a CoADR. This is only the second demonstra-ted CoA reductase activity, and the ﬁrst appearance of this activity in both the Archaea and in a ... concentration(as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a signiﬁcant level of identityto putative NADH oxidases from hyperthermophiles and bacterial NADH oxidases ... treated with dithiothreitol (5 mm) to reducethe disulﬁdes, and assayed as above. Thiols were quanti-ﬁed by comparison of peak areas to standard curves of those standards. Coenzyme A was measured...

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... (5¢-GCGCGGGATCCTCATTTAAGCATGAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order tointroduce an NcoI restriction site, an extra alanine codon(GCA) was ... A short-chain AdhA and an iron-containing AdhB encoded bythe lamA operon [10], and an oxygen-sensitive, iron and zinc-containing alcohol dehydrogenase which hasbeen puriﬁed from cell extracts ... theinitial activity of Pf-TDH was checked using butane-2,3-diol as substrate in the standard oxidation reaction and acetoin in the reduction reaction. The activity of Pf-TDH was signiﬁcantly increased...

Xem thêm