Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Journal 272 (2005) 1291–1304 ª 2005 FEBS Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and ... value, and safety of d-amino acids. Adv Exp Med Biol 289, 447– 481. 39 Lohmann KN, Gan S, John MC & Amasino RM (1994) Molecular analysis of natural leaf senescence...

Ngày tải lên: 16/03/2014, 18:20

... Mare  chal, P., Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein in Escherichia ... Storz, G. & Rhee, S.G. (1994) Cloning and sequencing of thiol-speci®c antioxidant from m ammalian brain: alkyl reductases and thiol- speci®c antioxidant de®ne a large family...

Ngày tải lên: 08/03/2014, 16:20

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts 3 and Ana Paula U. Arau ´ jo 1,2 1 Programa de Po ´ s-graduac a o em Gene ´ tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil 2 Instituto de Fı ´ sica de Sa˜o Carlos...

Ngày tải lên: 18/02/2014, 16:20

... (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); ... of two protein chains, each containing one variable and five constant domains, and functions as an antibody. In order to assess the antigen-binding capabilities of iso...

Ngày tải lên: 17/03/2014, 10:20

... temperature (1 h). Sequences of the upper strand of the duplexes are listed below. Sites of mutation are underlined: wt, 5¢-AGAGAGAA TGAGAGGCTTCCCAATAGC-3¢;mut1,5¢-AGAGAG AATGA TAGGCTTCACAATAGC-3¢;mut2,5¢-AGAG AGAATGA TAGGCTTCCCAATAGC-3¢;mut3,5¢-AGA GAGAATGAGAGGCTTC ACAATAGC-3¢. Binding ... XHIVEP1, 5¢-ATCCAGAGGCAGAAGCAG-3¢ and 5¢-CTGCATT CAGAGTAAGCC-3¢,60°C, 29 cycles; XHIVEP2, 5¢-AA...

Ngày tải lên: 30/03/2014, 13:20

... fungal tyrosinases, from both a structural and a functional point of view, are from Agaricus bisporus [10] and N. crassa [1]. Also, a few bacterial tyrosinases have been reported, of which Streptomyces tyrosinases ... tyro- sinases from N. crassa [26–28] and Agaricus [28] and Pycnoporus species [25] have an additional C-terminal domain that is proteolytically released...

Ngày tải lên: 19/02/2014, 06:20

... reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks 15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C...

Ngày tải lên: 19/02/2014, 07:20

... inves- tigation because of their physiological importance and their pharmaceutical relevance as drug carriers [1–6]. Both transporters catalyse the uptake of most dipep- tides and tripeptides and a variety ... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-...

Ngày tải lên: 07/03/2014, 05:20

... act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and...

Ngày tải lên: 07/03/2014, 17:20

... (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order to introduce an NcoI restriction site, an extra alanine codon (GCA) was ... A short- chain AdhA and an iron-containing AdhB encoded by the lamA operon [10], and an oxygen-sensitive, iron and zinc-containing alcohol dehydrogenase which has been purified fr...

Ngày tải lên: 16/03/2014, 14:20