Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Journal 272 (2005) 1291–1304 ª 2005 FEBS Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and ... value, and safety of d-amino acids. Adv Exp Med Biol 289, 447– 481. 39 Lohmann KN, Gan S, John MC & Amasino RM (1994) Molecular analysis of natural leaf senescence...

Ngày tải lên: 16/03/2014, 18:20

14 565 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... Mare  chal, P., Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein in Escherichia ... Storz, G. & Rhee, S.G. (1994) Cloning and sequencing of thiol-speci®c antioxidant from m ammalian brain: alkyl reductases and thiol- speci®c antioxidant de®ne a large family...

Ngày tải lên: 08/03/2014, 16:20

11 608 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts 3 and Ana Paula U. Arau ´ jo 1,2 1 Programa de Po ´ s-graduac a o em Gene ´ tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil 2 Instituto de Fı ´ sica de Sa˜o Carlos...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

... (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); ... of two protein chains, each containing one variable and five constant domains, and functions as an antibody. In order to assess the antigen-binding capabilities of iso...

Ngày tải lên: 17/03/2014, 10:20

12 522 0
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... temperature (1 h). Sequences of the upper strand of the duplexes are listed below. Sites of mutation are underlined: wt, 5¢-AGAGAGAA TGAGAGGCTTCCCAATAGC-3¢;mut1,5¢-AGAGAG AATGA TAGGCTTCACAATAGC-3¢;mut2,5¢-AGAG AGAATGA TAGGCTTCCCAATAGC-3¢;mut3,5¢-AGA GAGAATGAGAGGCTTC ACAATAGC-3¢. Binding ... XHIVEP1, 5¢-ATCCAGAGGCAGAAGCAG-3¢ and 5¢-CTGCATT CAGAGTAAGCC-3¢,60°C, 29 cycles; XHIVEP2, 5¢-AA...

Ngày tải lên: 30/03/2014, 13:20

10 414 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... fungal tyrosinases, from both a structural and a functional point of view, are from Agaricus bisporus [10] and N. crassa [1]. Also, a few bacterial tyrosinases have been reported, of which Streptomyces tyrosinases ... tyro- sinases from N. crassa [26–28] and Agaricus [28] and Pycnoporus species [25] have an additional C-terminal domain that is proteolytically released...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks 15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... inves- tigation because of their physiological importance and their pharmaceutical relevance as drug carriers [1–6]. Both transporters catalyse the uptake of most dipep- tides and tripeptides and a variety ... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and...

Ngày tải lên: 07/03/2014, 17:20

12 420 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order to introduce an NcoI restriction site, an extra alanine codon (GCA) was ... A short- chain AdhA and an iron-containing AdhB encoded by the lamA operon [10], and an oxygen-sensitive, iron and zinc-containing alcohol dehydrogenase which has been purified fr...

Ngày tải lên: 16/03/2014, 14:20

8 415 0
w