0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

... mMsodium orthovanadate and then assayedfor phosphorylation activity. (E) Phosphoamino-acid analysis of PknA. MBP–bgal control (lanes 1 and 3) and MB P–PknA fusion protein (lanes 2 and 4) after Western-blot ... PAPEREvidence that a eukaryotic- type serine/threonine protein kinase fromMycobacterium tuberculosisregulates morphologicalchanges associated with cell divisionRachna Chaba, Manoj Raje and ... functionality of any eukaryotic- type Ser/Thr kinase from M. tuberculosis. Identification of thenatural substrate of PknA in mycobacteria would a idprogress towards its utilization as a drug target,...
  • 8
  • 428
  • 0
Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for amplification of mitochondrial apoptotic cell death in human cervical cancer cells pptx

Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for amplification of mitochondrial apoptotic cell death in human cervical cancer cells pptx

... frommitochondria, and apoptotic cell death. Radiation also induced transcrip-tional upregulation of Fas, caspase-8 activation, Bax and Bak activation, and phosphorylation and downregulation of Bcl-2. ... effector domain (DED)domains of the adaptor molecule, Fas-associated deathdomain (FADD), and caspase-8. We performed co-immunoprecitation assays to analyze the association of FADD and caspase-8 ... anti-cytochrome c, anti-AIF and anti -a- tubulin serum. a- tubulin was used as a cytosolic marker protein. (C) Radiation induces apoptotic conformational changes of Bax and Bak after irradiation(10 Gy). Activity-related...
  • 13
  • 370
  • 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... interactor, isoform 1 (PPI1) is a novel interactor of the C-ter-minus of Arabidopsis thaliana plasma membrane H+-ATPase (EC 3.6.3.6)(Morandini P, Valera M, Albumi C, Bonza MC, Giacometti S, Ravera ... further enhances FC-stimulatedH+-ATPase activity [22].Here we report a characterization of the interaction of PPI1 with the H+-ATPase in PM isolated fromcontrol and FC-treated A. thaliana cultured...
  • 8
  • 629
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢;...
  • 14
  • 523
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, HirataM, Mazda O, Katsura Y & Narumiya S (1993)Thromboxane A2 receptor is highly expressed in mouseimmature thymocytes and mediates DNA fragmentation and apoptosis. ... pGL3e:Prm3AP)1*, pGL3b: Prm 3a AP)1*, pGL3e:Prm 3a AP)1*,pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b:Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1*.Mutation ... (TP) alpha and beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of the 5¢ untranslated region of alpha and betaisoforms of...
  • 18
  • 509
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... three sets of primers: first set, A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR products ... xTRHR1 and xTRHR2 subtypes were amplified as described above usingpartially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense...
  • 11
  • 506
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site.The ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid ... purification of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichiapastoris. Lane 1 shows standards (Low range and Polypeptide kits,Bio-Rad, France) and lanes 2–5 are...
  • 11
  • 642
  • 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase fromSaccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... Glu545Leu variant of ScPPDCwas prepared, and its kinetic parameters with the two substrates, PPA and IPyA, were determined. A com-parison of these and the parameters of the wild -type enzyme are presented ... kcatvalue for reaction of each variant with PPA islower than that of the wild -type enzyme and, with theexception of Q448W, Kmvalues are increased and kcat⁄ Kmvalues are reduced by almost...
  • 12
  • 436
  • 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... localization and induction by highlight. MolMicrobiol 69, 231–244.41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J(2007) Identification and biochemical characterization of a novel carotenoid ... ends of carotenoids.AbbreviationsCCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1,Oryza sativa carotenoid cleavage ... claim to original German government works 747 Characterization of the rice carotenoid cleavagedioxygenase 1 reveals a novel route for geranialbiosynthesisAndrea Ilg, Peter Beyer and Salim Al-BabiliFaculty...
  • 12
  • 497
  • 0
Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... GATCATGCACTGAAATTTA (2), GATGAAACCTCTCAAACTG (3), and CATCATCGCTGGACAATGT (4)], usingT. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1CFEBS Journal 274 (2007) 4812–4824 ª 2007 The Authors ... Dunkern and A. Hatzelmann Characterization of inhibitors of phosphodiesterase 1C on a human cellular systemTorsten R. Dunkern and Armin HatzelmannBiochemistry 2 Inflammation, ALTANA Pharma AG, Member ... LifeTechnologies, Grand Island, NY, USA), 2 mml-glutamine,1mm sodium pyruvate and 10% heat-inactivated fetalbovine serum at 37 °C and 5% CO2.Measurements of PDE isoenzyme activities and preparation of cellular...
  • 13
  • 462
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam