Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin 1 , Janice W. Kansy 1 , Angus C. Nairn 2,3 , ... E-mail: james.bibb@utsouthwestern.edu Abbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note: Nucleotide se...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCAT...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

... CCAACTTATGTCCCGACT CTGCATCTGTGAAAGT CaDHODH-rev, CCGGAATTCCTTATCATCAGAG CCAATTAT Ca-BamHI -for, GCGGATCCCGAATGTTTCGTCC AAGTATCAAATTCAAACAGTCG Cak-BamHI -for, GCGGATCCCGAATGTCAAGAT CAGCAATCCATGAATATGTTTTGTGC CaDHODH-rev3, CCGGAATTCTCACTTATCATC AGAGCCAATTATTTGCTCCCATG Expression ... ATGTTTCGTCCAAGTATCAAAT TC ZGCaURA1–3¢, TCACTTATCATCAGAGCC Ca-forlong2, ATGTTTCGTCCAAGTATCAAATTC AAACAGTCGACTTTGTC...

Ngày tải lên: 07/03/2014, 12:20

9 458 0
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... endosomal ⁄ prevacuolar structures. At 10 min, punctate staining diminished and vacuolar staining in- creased, and finally punctate staining was almost lost with predominant vacuolar staining at 30 ... Munn AL & Yang H (2005) AAA ATPases regulate membrane asso- ciation of yeast oxysterol binding proteins and sterol metabolism. EMBO J doi:10.1038. 35 Levine TP & Munro S (2001) D...

Ngày tải lên: 07/03/2014, 21:20

13 584 0
Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx

Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx

... m M 3,3¢-dimethoxybenzidine, and 7 U horseradish peroxidase. The increase in absorbance (460 nm) was compared to a standard curve, which was prepared separately using known amounts of H 2 O 2 .The assay was not disturbed ... a thermostatted cuvette holder. Initially, one standard method was used for measuring NADH oxidase activity of the recombinant gene products. The standard a...

Ngày tải lên: 08/03/2014, 02:21

10 531 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ....

Ngày tải lên: 08/03/2014, 10:20

11 502 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... M. K. Islam 1 , M. A. Alim 1 and Kozo Fujisaki 2,3 1 Laboratory of Parasitic Diseases, National Institute of Animal Health, Ibaraki, Japan 2 National Research Centre for Protozo...

Ngày tải lên: 16/03/2014, 10:20

14 433 0
Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

... 190 A 2 , and the buried surface area was 1211 A 2 . The ASA for the ESAT-6– CFP-10 solution structure was 11 512 A 2 , and the buried surface area was 1675 A 2 . The buried surface area for ... Ile17, Ala21, Leu24, Ala26, Ala30, Ile31, Ile32, Val35, Leu36, Ala38, Phe41, Cys50, Phe53, Leu57, Phe61, Val63, Ile64, Ala68, Ala70, Val75, Ala77, Ala78, Met82, Val89 and Ala94 of...

Ngày tải lên: 22/03/2014, 16:21

13 280 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and T7-containing reverse primer (5¢-TAATACG ACTCACTATAGGGAGACCGGCA TTGAGGATG CTG AT-3¢) for the antisense-strand ... Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn Marsup...

Ngày tải lên: 23/03/2014, 07:20

11 369 0
Báo cáo khoa học: Molecular characterization of artemin and ferritin from Artemia franciscana pot

Báo cáo khoa học: Molecular characterization of artemin and ferritin from Artemia franciscana pot

... poly (A) tail are shaded grey. The polyadenylation signals, AATAAA, are in bold and boxed, the ATTTA sequence and its variant ATTTTA are in bold and italicized, and a G/T stretch is in bold and shaded grey. Fig. ... Molecular characterization of artemin and ferritin from Artemia franciscana Tao Chen 1, *, Reinout Amons 2 , James S. Clegg 3 , Alden H. Warner 4 and Thomas...

Ngày tải lên: 23/03/2014, 20:22

9 415 0
w