Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx
Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx
... for human H -Ras and K -Ras were as described [36]. H -Ras exon 1 sense: 5 ¢-CTGAG GAGCGATGACGGAAT-3¢, H -Ras exon 2 antisense: 5¢-ACACACACAGGAAGCCCTCC-3¢,K-Rasexon1 sense: 5¢-CCTGCTGAAAATGACTGAAT-3 ... CMP- Neu5Ac:Galb1,4GlcNAc a2 ,6-sialyltransferase I; ST6Gal II, CMP- Neu5Ac:Galb1,4GlcNAc a2 ,6-sialyltransferase II; ST6GalNAc I, CMP-Neu5Ac:GalNAc a2 ,6-sialyltransferase I; Tc,...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx
... 0.05 Gly-Glu-pNA < 1 < 0.05 Gly-Arg-pNA < 1 < 0.05 Ala-Ala-Pro-pNA 4304 100 Ala-Phe-Pro-pNA 3258 76 Ala-Ala-Ala-pNA 2080 48 Pro-Leu-Gly-pNA 199 4.6 Ala-Ala-Phe-pNA 86 2.0 Suc-Ala-Ala-Phe-pNA < ... hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason- able rates clearly indicates exclusive cleavage of the anilide bond of Ala-Ala-Val-Ala-pNA. Our results...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... 2007) doi:10.1111/j.1742-4658.2007.05770.x Vertebrate metallothioneins are found to contain Zn(II) and variable amounts of Cu (I), in vivo, and are believed to be important for d 10 -metal control. To date, structural information is available for ... Cu (I)- loa- ded forms of mammalian MTs is rather limited. In vitro, Cu (I) titrations of isolated MT-2 and its sep- arate domains demo...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: 5-Bromodeoxyuridine induces transcription of repressed genes with disruption of nucleosome positioning pptx
... with EcoRV. After washing, the membrane was subjected to autora- diography and densitometric analysis using an image analyzer FLA-5000 (FUJIFILM, T okyo, Japan). Gene expression analysis Total RNA samples ... –125 AC CAGTATAAAAGTG TATA pRS-BAR1 CAGTGGATCCGTG Bam H I pRS-ΔTA/BAR1 pRS-ΔTA/BAR1 dThd 2 op Lane 3 41 2 B ACT1 BAR1 BAR1 TA/ BAR1 pRS- C DC D Fig. 6. Nucleosome positioning on p0RS-...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx
... R, Miralles V, Pallardo ´ FV, Vin ˜ a JR, Vento M, Vin ˜ aJ& Sastre J (2007) Oxidative stress as a signal to up-regu- late gamma-cystathionase in the fetal -to- neonatal transi- tion in rats. ... calcu- lated by normalization of measured concentrations of total cysteine in both plasma and erythrocytes to the relative hematocrit value. Values are expressed as thiol equivalents. D...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc
... that is active against certain human pathogens such as Salmonella and Shigella [1], has an unusual lasso distinctive structure [2–4] and a dual mechanism of action. Microcin J25 inhibits transcription ... concentrations were calculated from a standard measurement. Superoxide anion radical generation The rate of O À 2 generation by submitochondrial particles was measured as reduction of ac...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Okadaic acid induces DNA fragmentation via caspase-3-dependent and caspase-3-independent pathways in Chinese hamster ovary (CHO)-K1 cells pot
... 5¢-RACE and 3¢-RACE. RACE primers (5¢-GGAGAACACTGAAAACT CAGTGGATTC-3¢ and 5¢-TGGATGAACCAGGAGCCA TCC-3¢) were designed according to GenBank database coding sequence (CDs) of CHO-K1 caspase-3 cDNA (accession ... cleavage. An inability to block caspase-3 cleavage may cause the nuclear trans- location of active caspase-3 and DNA fragmentation in CHO-K1 cells. It appears that caspase-3 can tra...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... purported DNA strand cleavage [35,36] was due to a contaminat- ing protein that is either an accessory protein or a minor recombinant protein [34]. Studies show that an R8 8A mutation (arginine to alanine) ... appear to belong to multiple classes (Fig. 3), which we have classified as small-loop (Class I) and large-loop (Class II) i-motif G-quadruplex and i-motif in oncogene pr...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Transgenic Cdx2 induces endogenous Cdx1 in intestinal metaplasia of Cdx2-transgenic mouse stomach pot
... 867–871. 7 Mutoh H, Sakurai S, Satoh K, Tamada K, Kita H, Osawa H, Tomiyama T, Sato Y, Yamamoto H, Isoda N et al. (2004) Development of gastric carcinoma from intestinal metaplasia in Cdx2-transgenic ... )212] AGTG TATTTAGGTTGGAAGGAG CpG-Cdx2-fw2 [)206 ⁄ )185] GTAG TTAGTAAGAAGGGTTTGA CpG-Cdx2-rv [+194 ⁄ +173] TA ACTAACTACACCTCAACCCA Primers used for ChIP assay Cdx1 promoter- fw1 CTAGGGTCATGC...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ for 4-1BB, 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and 5¢-CCCGGGATATCTAAGTGCTGG TCTCCACAATGCACT-3¢ for TRAF1. Isolation of RNA and RT-PCR Sub-confluent ... that overexpressed 4-1BB or TRAF1 were designated HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNA...
Ngày tải lên: 23/03/2014, 18:20