... implicated in a large number of molecu- lar processes related to human diseases, including cancer and Alzheimer’s disease. Pin1 is made up of a WW interaction domain and a C-terminal catalytic ... ver- sus catalysis’ remains an open issue in many cases [2], partly because tinkering with the enzymatic activity through mutations also leads to changes in interaction parameters [3...
Ngày tải lên: 07/03/2014, 05:20
... University, Tokyo, Japan. Rhizopus sp. glucoamylase was obtained from Toy- obo Co., Ltd (Osaka, Japan). BM CGTase was obtained from Amano Enzyme Inc. (Aichi, Japan) and had a specific activity of 1003 ... BM was Table 1. Degree of derivatization of the CGTases from A1 1 and BM obtained with different protein ⁄ itaconic anhydride ratios and remaining cyclization activity. Ratio a (w...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Molecular identification of monomeric aspartate racemase from Bifidobacterium bifidum pptx
... exclusively acts on L -and D -aspartate. Other amino acids, including both enantiomers of glutamate, asparagines, glutamine, alanine, serine, lysine, and arginine, were inactive as substrates. The ... PLP-independent racemase [6], participates in the supply o f D -glutamate. Most bacterial alanine racemases assemble in a dimer structure [5], w hereas glutamate r acemases are m ainly...
Ngày tải lên: 07/03/2014, 16:20
Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx
... expression and activity of CYP2E1 were downregulated in a rat hepatoma cell line after the administration of proinflammatory cytokines, leading to a loss of catalytic activity. This downregulation was at ... response. Abbreviations ALT, alanine aminotrasferase; AST, aspartate aminotrasferase; CLP, cecal ligation and puncture; CYP, cytochrome P450; GdCl 3 , gadolinium chloride; GSH, g...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx
... hormone-dependent manner [63]. Most NRs share a common structural organization that includes a DNA-binding domain, a ligand-binding domain and a transactivation domain. The DNA-bind- ing domain is responsible ... observations, MLL1 appears to act as a histone methylase during basal transcription whereas MLL2, MLL3 and MLL4 replace MLL1 during activated transcription and act as...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... (proposed) natural domain-swapping evolution- ary process, domain unswapping relied on selection for catalytic activity. In this case, two amino acids, Lys20 and Leu21, were duplicated and a random ... the dehydratase and the dehydrogenase are provided by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strain and the ability of a cell harboring an individual l...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Tetracysteine-tagged prion protein allows discrimination between the native and converted forms pptx
... -TCC CAG GCC TAT TAC TGT TGT CCA GGA TGT TGT GAC GGG AGA AGA TCC-3¢) and antisense (5¢-GGA TCT TCT CCC GTC ACA ACA TCC TGG ACA ACA GTA ATA GGC CTG GGA-3¢) oligonucleotides were used to insert ... Petric A, Huang SC et al. (2002) Localization of neurofibril- lary tangles and beta-amyloid plaques in the brains of living patients with Alzheimer disease. Am J Geriatr Psychiatry 10, 24–35. 6...
Ngày tải lên: 06/03/2014, 11:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAA...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc
... helices a1 and a2 , and loop 130, spanning strands b6 and b7. Eight amino acids interact directly (< 4 A ˚ ) with GriP: the majority of contacts are made between charged groups, and these include ... noncovalently bound FAD per 47-kDa protein monomer. GO cata- lyzes the dioxygen-dependent oxidative deamination of primary and secondary amines (sarcosine, N-ethylgly- cine, and...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Survival mechanisms of pathogenic Mycobacterium tuberculosis H37Rv ppt
... (e.g. microarrays and proteomics), in combination with modern approaches, has facilitated a more rational and directional approach towards the understanding of these mechanisms. Therefore, it is clear ... products called the antigen 85 complex, each having fibronectin binding capacity and thus an important role in disease pathogenesis [17]. LAM is also a major constituent of myc...
Ngày tải lên: 16/02/2014, 15:20