Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... O2affinity, K , can be derived for both the < /b> a < /b> and < /b> b subunits from the < /b> averaged parameters of< /b> HbA oxygenation < /b> (Table 1, Average). The < /b> association and < /b> dissociation rate constants for the < /b> b subunits are ... effects < /b> of < /b> pH and < /b> NaCl on < /b> the < /b> bimolecularassociation rate constant of < /b> O2rebinding and < /b> the< /b> quantum yield of < /b> BR for the < /b> a < /b> and < /b> b subunits within the < /b> liganded < /b> dimer and < /b> tetramer of < /b> hemoglobin < /b> weredetermined. ... DAnormis a < /b> normalized change in optical density of < /b> the < /b> sample and < /b> a< /b> a, a< /b> b , k¢ a < /b> and < /b> k¢ b are the < /b> ampli-tudes and < /b> rate constants of < /b> BR. The < /b> quantity [O2]is the < /b> concentration of < /b> molecular oxygen...
- 11
- 577
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... calibration standards provided by the < /b> manu-facturer. Data processing was performed using the < /b> deconvo-lution module of < /b> the < /b> data analysis software to detect the< /b> multiple charge states and < /b> obtain ... 4183Structural effects < /b> of < /b> a < /b> dimer interface mutation on< /b> catalytic activity of < /b> triosephosphate isomerase The < /b> role of < /b> conserved residues and < /b> complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... of < /b> histones H3 and < /b> H4) displayed potent bacterici-dal activity mainly against Gram-negative bacteria, aneffect that was amplified by acid media, whereas a < /b> lysine-rich preparation (fraction A:< /b> ... nuclearmaterials that include DNA and < /b> bactericidal proteins and < /b> histone-derived peptides such as buforins and < /b> pos-sibly HN. The < /b> inflammation is also accompanied by the < /b> release of < /b> large amounts of < /b> ATP ... oxidation DNP (A,< /b> B) , the< /b> aconitase inhibitor fluoroacetate (C, D) and< /b> the < /b> inhibitor of < /b> DNA gyrase-linked ATPase,coumermycin A1< /b> (E, F) on < /b> the < /b> bactericidalactivity of < /b> H4-(86–100) and < /b> ciprofloxacinagainst...
- 12
- 756
- 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... antagonism in the < /b> REF assay, subcellular localization, and < /b> transcrip-tional activity. Some of < /b> these analyses have assigneddifferential functions to the < /b> two isoforms, and < /b> we showthat the < /b> unique ... ‘SRaDPRD’bar with the < /b> black ‘SRb’ bar in Fig. 3B) . Said anotherway, deletion of < /b> the < /b> 61 amino acid PRD from Mxi1-SRa converts Mxi1-SRa into a < /b> potent suppressor of< /b> Myc+Ras transformation. Of < /b> note, the < /b> ... report describing Mxi1-SRa, this isoformappeared functionally homologous to Mxi1-SRb in thatboth could bind to Max and < /b> Sin3 and < /b> repress bothbasal and < /b> Myc-activated transcription of < /b> various repor-ter...
- 11
- 586
- 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... Institute of < /b> Molecular Biology Academia S inica, Taipei, TaiwanVolvatoxin A < /b> (VVA) has been isolated from Volvari-ella volvacea, and < /b> consists of < /b> volvatoxin A2< /b> (VVA2) and < /b> volvatoxin A1< /b> (VVA1) [1]. VVA ... for interaction with two molecules of< /b> VVA2, and < /b> that large amounts of < /b> free VVA2 can useVVA1 as a < /b> basis for the < /b> formation of < /b> VVA2 oligomers.Interaction of < /b> VVA1 and < /b> VVA2 by amphipathic a-< /b> helixTo ... beads] (Fig. 4B) . VVA1 (VVA2beads) was incubated with increasing amounts of< /b> VVA2, and < /b> visualization on < /b> an SDS ⁄ PAGE gel showedthat the < /b> adsorbed VVA2 had oligomerized. As the< /b> amount of < /b> VVA2...
- 12
- 585
- 0
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx
... strongly support the < /b> notion that the< /b> antifungal activity of < /b> VtA3is due to membrane binding and < /b> channel forma-tion, leading to destabilization and < /b> disruption of < /b> the < /b> plasma membrane,thereby ... [16]. We have also reported the < /b> interaction of< /b> VtA3 and < /b> VtB with model membranes and < /b> suggestedthat their biological activity may be ascribed to mem-brane permeabilization [3]. It has also been ... [47]. Therefore, the < /b> lag timeobserved between the < /b> increase in membrane conduct-ance and < /b> the < /b> appearance of < /b> channel activity may be rela-ted to the < /b> assembly of < /b> the < /b> putative complex into the< /b> bilayer....
- 12
- 530
- 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... nucleotides mediate a < /b> reductionin the < /b> elongation rate and < /b> influence the < /b> accuracy of< /b> translation. Early results indicated that (p)ppGpp affecttranslation by inhibition of < /b> elongation factors Tu, Ts and < /b> G[17–19]. ... (5¢-TAATACGACTCACTATAGGGGAATTG-3¢) and < /b> reverse primer Int R (5¢-CCCATGACCTTATTACCAACCTC-3¢), respectively. The < /b> final amplifiedfragment was digested with XbaI and < /b> KpnI and < /b> inserted intopAB146. The < /b> ... for purification ensured that the< /b> recombinant proteins have the < /b> same number of < /b> amino acidsas the < /b> native elongation factors.Activity assays The < /b> concentration of < /b> EF-Tu active in binding guaninenucleotides,...
- 12
- 502
- 0
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx
... werecombined with Filtron-X scintillant (National D iagnostics,Atlanta, GA, USA) and < /b> radioactivity was measured using a< /b> beta counter (2200CA Tri-carb Liquid Scintillation Ana-lyser; Canberra Packard, ... glucose, amino and < /b> fattyacid mobilization, and < /b> loss of < /b> bone [2]. In addition,endogenous glucocorticoids p articipate in feedback inhibi-tion of < /b> the < /b> hypothalamo-pituitary-adrenal axis, and < /b> long-term ... inhibitory effect of < /b> RU486 acting at the < /b> level of< /b> arachidonic acid release (Fig. 3B) .Transactivation and < /b> transrepression by glucocorticoids and < /b> RU486 The < /b> effect of < /b> dexamethasone and < /b> R U486 was a...
- 11
- 527
- 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx
... CCTGATACGTCTTGGTCTTCATCABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACATABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGGABCC11 3025–3560 CCACGGCCCTGCACAACAAG GGAATTGCCAAAAGCCACGAACA100000100001000100101MRP1-HEK293 ... Position of < /b> primer Forward oligo sequence Reverse oligo sequenceABCB1 834–1086 GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGCABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATCABCC4 ... polyphenols in the < /b> presence and < /b> absence of < /b> BeFx. The< /b> reaction was initiated by addition of < /b> 5 mM ATP and < /b> terminated withSDS (2.5% final concentration) after 20 min incubation at 37 °C. The < /b> amount of < /b> Pireleased...
- 16
- 517
- 0
Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot
... Hayashibara Biochemical Laboratories, Inc. (Okayama,Japan) and < /b> Novartis Pharma Inc. (Tokyo), respectively.Preparation of < /b> mitochondriaMitochondria were isolated from the < /b> liver of < /b> normal maleWistar rats, ... with Ca2+or DiS-C3(5) as described inthelegendinFig.4andsubjectedtoTEManalysis. ( A)< /b> The < /b> appearance of < /b> n ontreatedcontrol mitochondria. (B) and < /b> (C) The< /b> appearances o f mitochondria t reated ... DiS-C3(5)inanoxygenchamber at 25 °C as stated above. After certain periods of< /b> incubation, a < /b> 500 lL aliquot of < /b> the < /b> reaction mixture wastaken i nto an E ppendorf tube, a < /b> nd the < /b> mitochond rial pellet and < /b> supernatant...
- 7
- 481
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ