Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... O 2 affinity, K , can be derived for both the < /b> a < /b> and < /b> b subunits from the < /b> averaged parameters of < /b> HbA oxygenation < /b> (Table 1, Average). The < /b> association and < /b> dissociation rate constants for the < /b> b subunits are ... effects < /b> of < /b> pH and < /b> NaCl on < /b> the < /b> bimolecular association rate constant of < /b> O 2...
Ngày tải lên: 16/03/2014, 14:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... calibration standards provided by the < /b> manu- facturer. Data processing was performed using the < /b> deconvo- lution module of < /b> the < /b> data analysis software to detect the <...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... of < /b> histones H3 and < /b> H4) displayed potent bacterici- dal activity mainly against Gram-negative bacteria, an effect that was amplified by acid media, whereas a < /b> lysine-rich preparation (fraction A:< /b> ... nuclear materials that include DNA and < /b> bactericidal proteins and < /b> histone-derived peptides such as buforins and < /b> pos- sibly HN. The < /b> inflammation...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... antagonism in the < /b> REF assay, subcellular localization, and < /b> transcrip- tional activity. Some of < /b> these analyses have assigned differential functions to the < /b> two isoforms, and < /b> we show that the < /b> unique ... ‘SRaDPRD’ bar with the < /b> black ‘SRb’ bar in Fig. 3B) . Said another way, deletion of < /b> the < /b> 61 amino acid PRD from Mxi1- SRa converts Mx...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... Institute of < /b> Molecular Biology Academia S inica, Taipei, Taiwan Volvatoxin A < /b> (VVA) has been isolated from Volvari- ella volvacea, and < /b> consists of < /b> volvatoxin A2< /b> (VVA2) and < /b> volvatoxin A1< /b> (VVA1) [1]. VVA ... for interaction with two molecules of < /b> VVA2, and < /b> that large amounts of < /b> free VVA2 can use VVA1 as a < /b> basis for the <...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx
... strongly support the < /b> notion that the < /b> antifungal activity of < /b> VtA 3 is due to membrane binding and < /b> channel forma- tion, leading to destabilization and < /b> disruption of < /b> the < /b> plasma membrane, thereby ... [16]. We have also reported the < /b> interaction of < /b> VtA 3 and < /b> VtB with model membranes and < /b> suggested that their biological act...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... nucleotides mediate a < /b> reduction in the < /b> elongation rate and < /b> influence the < /b> accuracy of < /b> translation. Early results indicated that (p)ppGpp affect translation by inhibition of < /b> elongation factors Tu, Ts and < /b> G [17–19]. ... (5¢-TAATACGACTCACTATAGGGGA ATTG-3¢) and < /b> reverse primer Int R (5¢-CCCATGACCT TATTACCAACCTC-3¢), respectively. The < /b> fina...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx
... were combined with Filtron-X scintillant (National D iagnostics, Atlanta, GA, USA) and < /b> radioactivity was measured using a < /b> beta counter (2200CA Tri-carb Liquid Scintillation Ana- lyser; Canberra Packard, ... glucose, amino and < /b> fatty acid mobilization, and < /b> loss of < /b> bone [2]. In addition, endogenous glucocorticoids p articipate in feedback inhibi- tion of < /b>...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx
... CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGG ABCC11 3025–3560 CCACGGCCCTGCACAACAAG GGAATTGCCAAAAGCCACGAACA 100000 10000 1000 100 10 1 MRP1-HEK293 ... Position of < /b> primer Forward oligo sequence Reverse oligo sequence ABCB1 834–1086 GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGC ABCC1 11...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot
... Hayashibara Biochemical Laboratories, Inc. (Okayama, Japan) and < /b> Novartis Pharma Inc. (Tokyo), respectively. Preparation of < /b> mitochondria Mitochondria were isolated from the < /b> liver of < /b> normal male Wistar rats, ... with Ca 2+ or DiS-C 3 (5) as described in thelegendinFig.4andsubjectedtoTEM analysis. ( A)< /b> The < /b> appearance of < /b> n ontreated control mitochon...
Ngày tải lên: 16/03/2014, 18:20