Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢,5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢,5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and ... Journal compilation ª 2006 FEBS 1223 Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a heme- r...

Ngày tải lên: 16/03/2014, 13:20

14 390 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

... oligonucleotides: Asp40Ala: 5¢-TGTTAATTAACGAAAATGC TGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTC AGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAAC GAAGTGATGTTTTTCA AC-3¢ (forward); ... Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and cataly...

Ngày tải lên: 19/02/2014, 16:20

6 424 0
Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx

Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx

... deprotonating the C2 hydroxy group to form an oxaloacetate intermediate and in facilitating the hydride transfer from C2 to NADP + . After decarboxylation of oxaloacetate, a general acid partici- pates ... with the carbonyl oxygen of oxaloacetate and facilitate the decarboxylation reaction to form enol- pyruvate [21]. Our kinetic data on the D23 5A mutant demonstrated...

Ngày tải lên: 23/03/2014, 10:21

10 316 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

... study, the catalytic domains are indicated by capital letters ( A and B) and the C-terminal peptides by lower case letters (a and b), so that the wild-type enzymes are abbreviated as Aa and Bb. The ... protein or alkaline phos- phatase allowed the formation of tetramers associated with an N-terminal fragment of ColQ [17]. However, the catalytic domains are also invo...

Ngày tải lên: 07/03/2014, 03:20

15 446 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

... be involved. In multicellular organisms, GATA-binding factors play critical roles in development, including cell-fate specification, regulation of differentiation, and control of cell proliferation and ... loops of c-T1 and c-T2 pro- mote the lateral interactions necessary to form the c-TuRC ring template at cold temperatures [12,35] and that the residue substitut...

Ngày tải lên: 07/03/2014, 04:20

16 468 0
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

... (5¢-atagacacgcaaacacaaatacaca cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC CAGC-3¢). The sequences in lower-case ... was generated by disrupting the ATF2 gene of CA10 with the KanMX4 cassette, which confers G418 resistance. Primers 5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTC...

Ngày tải lên: 08/03/2014, 08:20

13 441 0
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf

Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf

... (5¢-to3¢) Mutant GSTU1 E117K-for: AAGACATGGACCACA AAGGGAGAAGAGCAGGAG E117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATC RKI GSTU2 P89R-for: TGGCTTCCCTCTGATC GCTACCAGAGAGCTCAA P89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC RKV GSTU1 ... TTGCTTCCCTCTGATC CCTACCAGAGAGCTCAA R89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC PEI PEI E117K-for: TTTGGAAAGTCCAGC ATTGAGGCTGAGTGCCCC E117K-rev: GCTGGACTTTCCAAATGTCTCATA PKI Functional ro...

Ngày tải lên: 15/03/2014, 09:20

8 421 1
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

... yields information on the chemical nature of the individual radicals of the radi- cal pair state, and their interaction with each other and with their immediate surroundings. EPR ⁄ ENDOR investigations ... Thus, replacement of His354 by alanine leads to significant modification of the cofactor- binding site at the 8a- methyl group and at the linkage of the ribi...

Ngày tải lên: 16/03/2014, 02:20

14 379 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot

... with other flavin amine oxidases, including the overall fold of the amine oxidase domain region and details in the active site that are relevant for amine substrate oxidation. Abbreviations AOD, amine ... whereas in MAO A, MAO B and MAO N the aromatic substrates bind in a hydrophobic cavity that, in MAO B (Fig. 3A) , has a bipartite nature and is shaped by a loo...

Ngày tải lên: 16/03/2014, 02:20

9 308 1
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx

... state governs the association of Yap4p and Lot6p. Although it appears likely that the redox state of the FAD cofactor of NQO1 and NQO2 plays a similar role in the mammalian system, unequivocal ... protein [24], removing ubiquitin chains for recycling [25,26] and opening an axial gate into the 20S catalytic chamber [27]. Whereas 26S proteasomal degradation requires...

Ngày tải lên: 16/03/2014, 02:20

12 424 0
Từ khóa:
w