Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... DosH as a template and using the following respective 5¢-sense primers: 5¢-gatgagtcgggagACCcagctggagaaaaaag-3¢,5¢-gatgagtcgggagTTTcagctggagaaaaaag-3¢,5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and ... Journal compilation ª 2006 FEBS 1223 Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a heme- regulated phosphodiesterase from Escherichia coli Nao ... physicochemicalcharacteristics such as auto-oxidation and the redox potential of the heme iron. We found that mutation of these hydrophobic amino acids substantially in uences the rate of auto-oxidation...
- 14
- 390
- 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... oligonucleotides: Asp40Ala:5¢-TGTTAATTAACGAAAATGC TGAAGTGATGTTTTTC-3¢ (forward); 3¢-GAAAAACATCACTTC AGCATTTCGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTTAATTAACGAAAATAAC GAAGTGATGTTTTTCAAC-3¢ (forward); ... Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic controlMiki Watanabe, Hirofumi ... domain, which are critical in catalysis. In contrast to data obt ained with Met95Ala and Met95Leu mutants [15–18], Asp40 mutations increased the redox poten tials and auto-oxidation rates. The...
- 6
- 423
- 0
Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx
... deprotonating the C2 hydroxy group toform an oxaloacetate intermediate and in facilitating the hydride transfer from C2 to NADP+. Afterdecarboxylation of oxaloacetate, a general acid partici-pates ... with the carbonyl oxygen of oxaloacetate and facilitate the decarboxylation reaction to form enol-pyruvate [21]. Our kinetic data on the D23 5A mutantdemonstrated a dramatic decrease in kcatvalues ... concentra-tions. The extent of activation was underestimatedbecause of the presence of unsaturated l-malate and Mn2+ in the assay mixture. To investigate the re-acti-vation process further, kinetic parameters...
- 10
- 316
- 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
... study, the catalytic domains are indicated by capital letters ( A and B) and the C-terminal peptides by lower case letters (a and b), so that the wild-type enzymes are abbreviated asAa and Bb. The ... protein or alkaline phos-phatase allowed the formation of tetramers associatedwith an N-terminal fragment of ColQ [17]. However, the catalytic domains are also involved in quaternaryinteractions ... patterns of oligomers were similar for Aa and Ab, as well as for Ba and Bb, indicat-ing a predominant in uence of the catalytic domains. However, addition of a cysteine within the aromatic-rich...
- 15
- 446
- 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... beinvolved. In multicellular organisms, GATA-bindingfactors play critical roles in development, includingcell-fate specification, regulation of differentiation, and control of cell proliferation and ... loops of c-T1 and c-T2 pro-mote the lateral interactions necessary to form the c-TuRC ring template at cold temperatures [12,35] and that the residue substitutions and conformationalchanges at the ... denaturation at 95 °C for 2 min to activate the polymerase followed by 45cycles of denaturation at 95 °C for 30 s and annealing and extension at 60 °C for 15 s each. Following amplification,melting...
- 16
- 467
- 0
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx
... (5¢-atagacacgcaaacacaaatacacacactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGGCAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcggaattcgagctcggtacccgggTCATTCTTTATTTAGAGCATCCAGC-3¢). The sequences in lower-case ... wasgenerated by disrupting the ATF2 gene of CA10 with the KanMX4 cassette, which confers G418 resistance. Primers5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTTCAGCAATAAAAATTGTCCAGGTTAATtccagcgacatggaggccc-3¢ ... 5¢-AGACTTTCAAACGAATAATAACTTCAGCAATAAAAATTGTCCAGGTTAATtccagcgacatggaggccc-3¢ and 3¢ATF2-Kan: 5¢-TTGTACGAGCTCGGCCGAGCTATACGAAGGCCCGCTACGGCAGTATCGCAcattcacatacgattgacgc-3¢ (nucleotides in lower case arespecific to the KanMX4 module) were used for PCR withpFA6-MX4 as...
- 13
- 441
- 0
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... (5¢-to3¢) MutantGSTU1 E117K-for: AAGACATGGACCACAAAGGGAGAAGAGCAGGAGE117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATCRKIGSTU2 P89R-for: TGGCTTCCCTCTGATCGCTACCAGAGAGCTCAAP89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTCRKVGSTU1 ... TTGCTTCCCTCTGATCCCTACCAGAGAGCTCAAR89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTCPEIPEI E117K-for: TTTGGAAAGTCCAGCATTGAGGCTGAGTGCCCCE117K-rev: GCTGGACTTTCCAAATGTCTCATAPKIFunctional role of the GST H-site ... for the determination of CDNBapparent Km and Vmaxvalues, GSH was used at a fixedconcentration of 1 mm and the CDNB concentration wasvaried in the range 0.1–1 mm. The kinetic parameters werederived...
- 8
- 421
- 1
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx
... yields information on the chemical nature of the individual radicals of the radi-cal pair state, and their interaction with each other and with their immediate surroundings.EPR ⁄ ENDOR investigations ... Thus, replacement of His354 by alanineleads to significant modification of the cofactor-binding site at the 8a- methyl group and at the linkage of the ribityl side chain. Hence, as a first result, ... correlated coupled radical pairmodel and assuming the fixed orientations of the Trp324•radical and the flavin radical given by the 3Dstructure of the protein [86]. The strength of the dipolarinteraction...
- 14
- 379
- 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot
... withother flavin amine oxidases, including the overall fold of the amine oxidasedomain region and details in the active site that are relevant for aminesubstrate oxidation.AbbreviationsAOD, amine ... whereas in MAO A, MAO B and MAO N the aromatic substrates bind in a hydrophobic cavity that, in MAO B (Fig. 3A) , has a bipartite nature and is shaped by a loop that providesaccess to the enzyme active ... demon-strated that these aromatic residues may have a stericrole in substrate binding and in increasing the nucleo-philicity of the substrate amine moiety [43]. In LSD1one of these aromatic residues...
- 9
- 307
- 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx
... state governs the association of Yap4p and Lot6p. Although it appears likely that the redox state of the FAD cofactor of NQO1 and NQO2 plays a similar role in the mammalian system,unequivocal ... protein [24], removing ubiquitin chainsfor recycling [25,26] and opening an axial gate into the 20S catalytic chamber [27]. Whereas 26S proteasomaldegradation requires ubiquitination of substrate ... substrate is still a matter of debate, the reaction appears to play a pivotal role in quinone detoxificationby preventing the generation of potentially harmful semiquinones. In recentyears, an additional...
- 12
- 424
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ