0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

... proteins [6,7]. S-Layer fusion proteins based onthe S-layer proteins, SbsB, SbsC and SbpA, incorpor-ate an accessible N-terminal SCWP-binding domain,the self-assembly domain, as well as a biologically ... andnonlinear optics or catalysts [2,3,5,6,9–11].General aspects of S-layers S-Layer proteins are widely distributed in the majorlineages of archaea and in Gram-positive and Gram-negative bacteria ... S-layer proteins of Gram-positive bacteriaat least, common structural organization principleshave been identified. A cell-wall-targeting domain wasfound at the N-terminal region of many S-layer...
  • 12
  • 515
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the system at ... supplies information about the semantic structure of concepts associated with English words, particularly verbs. For example, the verb abridge has an associated case frame consisting of an agent...
  • 5
  • 416
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... This example, as well as all sample questions and paraphrases that follow, were, =aken from actual sessions with the paraphraser. Question (A) mad its possible paraphcases (B) and (C) are the ... represent information assumed by the questioner to be true of the database domain. This lapeling of information within the question will allow the construction of a natural paraphrase, avoiding ambiquity. ... used by the paraphraser to generate questions. I • INTRO~ION In a natural language interface to a database query system, a paraphraser can be used to ensure that the system has correctly understood...
  • 6
  • 532
  • 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... N-terminal signal peptide (amino acids1–36), we retained amino acid 36, an alanine, ratherthan using amino acid 37, a lysine, because it isknown that, after a post-translational processing of ... pre-pro-tyrosinase (Fig. S1) can be dividedapproximately into three domains: a twin argininetranslocase (TAT) signal peptide, a core domain con-taining the two copper-binding motifs and a C-termi-nal ... mm ascorbate (pH 6). To this, 0.7 mL of gla-cial acetic acid containing 0.5 mgÆmL)1of 2,2-biquinolinewas added. The mixture was incubated for 10 min at roomtemperature and A 546was measured,...
  • 13
  • 778
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

... Balla and A. Fern. 2009. UCT for tactical assaultplanning in real-time strategy games. In 21st Interna-tional Joint Conference on Artificial Intelligence.Darse Billings, Lourdes Pe˜na Castillo, ... terrain.S S AA AA AS When the settlers becomes active, chose build road. A AS SS A Use settlers or engineers to improve a terrain square within the city radius A A A SA SSSSS✘✘Phalanxes are ... built -in AI.7 ResultsGame performance As shown in Table 1, our lan-guage aware Monte-Carlo algorithm substantiallyoutperforms several baselines – on average winning53.7% of all games within...
  • 10
  • 508
  • 0
Báo cáo khoa học: Peroxisomes as dynamic organelles: peroxisome abundance in yeast docx

Báo cáo khoa học: Peroxisomes as dynamic organelles: peroxisome abundance in yeast docx

... abundance in yeastFEBS Journal 277 (2010) 3279–3288 ª 2010 The Authors Journal compilation ª 2010 FEBS 32855 Tam YY, Fagarasanu A, Fagarasanu M & RachubinskiRA (2005) Pex3p initiates the formation ... forcaveolin-1 at peroxisomes in mammalian cells [41].Caveolin-1 is crucial for the formation of caveolae,subtypes of microdomains ⁄ rafts that are morphologi-cally recognizable as flask-like invaginations ... strains [28] indeed indicated thatphosphorylation processes are crucial in regulating per-oxisome abundance. In particular, deletion of PHO85, a cyclin-dependent kinase, had a strongly negativeeffect...
  • 10
  • 288
  • 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGCC3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K ... (5¢fi3¢)MA(9)ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X ... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 AATTAACCCTCACTAAAGGGB1 GCCGGGATCCTAGGGCGAATTGGGTACC864 T. Utsumi et al. (Eur. J. Biochem....
  • 12
  • 512
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

... Experimental EvaluationThe advantage of structuring the lemmatisation task as a tagging task is that it allows us to apply success-ful tagging techniques and use the context informa-tion in assigning ... accuracy known oneight European languages having different morpho-logical complexity, including agglutinative (Hungar-ian, Estonian) and fusional (Slavic) languages.2 Lemmatisation as a Tagging ... Genevatanja.samardzic@unige.chAbstractWe present a novel approach to the task ofword lemmatisation. We formalise lemmati-sation as a category tagging task, by describ-ing how a word-to-lemma...
  • 5
  • 456
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

... ProblemSiva ReddyIIIT HyderabadIndiagvsreddy@students.iiit.ac .in Abhilash InumellaIIIT HyderabadIndiaabhilashi@students.iiit.ac .in AbstractThis work models Word Sense Disam-biguation (WSD) ... deter-mined. We define the sense of a word as its vari-able. Each agent wiis associated with the variableswi. The value assigned to this variable indicatesthe sense assigned by the algorithm.3.3 ... approaches: These approachescrucially rely on lexical knowledge base.Graph-based WSD approaches (Agirre andSoroa, 2009; Sinha and Mihalcea, 2007) per-form disambiguation over a graph composedof...
  • 6
  • 369
  • 0
Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

... isdefined as [(ASA of A) + (ASA of B) ) (ASA of AB dimer)] ⁄ 2. Thenumber of water molecules in the dimer interface was detectedwithASV CALCULATOR [34]. ASA was calculated with a program kindlyprovided ... under the accession number3AUP.AbbreviationsANXY, Aspergillus niger xylanase; ASA, accessible surface area; AUC, analytical ultracentrifugation; BTB, back-to-back; Bg7S, basic 7Sglobulin; EDGP, ... with larger DASA is moreplausible. We found that the DASAs of the AB andDA dimers were comparable. Although the DASA ofthe CD dimer was slightly larger than the others, thiswas attributable...
  • 11
  • 524
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam