Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

Báo cáo khoa học: S-Layers as a basic building block in a molecular construction kit ppt

... proteins [6,7]. S-Layer fusion proteins based on the S-layer proteins, SbsB, SbsC and SbpA, incorpor- ate an accessible N-terminal SCWP-binding domain, the self-assembly domain, as well as a biologically ... and nonlinear optics or catalysts [2,3,5,6,9–11]. General aspects of S-layers S-Layer proteins are widely distributed in the major lineages of archaea and in Gram-positive and...

Ngày tải lên: 16/03/2014, 12:20

12 516 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the...

Ngày tải lên: 20/02/2014, 18:20

5 417 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... This example, as well as all sample questions and paraphrases that follow, were, =aken from actual sessions with the paraphraser. Question (A) mad its possible paraphcases (B) and (C) are the ... represent information assumed by the questioner to be true of the database domain. This lapeling of information within the question will allow the construction of a natural paraphrase...

Ngày tải lên: 21/02/2014, 20:20

6 533 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... N-terminal signal peptide (amino acids 1–36), we retained amino acid 36, an alanine, rather than using amino acid 37, a lysine, because it is known that, after a post-translational processing of ... pre-pro-tyrosinase (Fig. S1) can be divided approximately into three domains: a twin arginine translocase (TAT) signal peptide, a core domain con- taining the two copper-binding motifs and...

Ngày tải lên: 06/03/2014, 11:20

13 779 0
Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

... Balla and A. Fern. 2009. UCT for tactical assault planning in real-time strategy games. In 21st Interna- tional Joint Conference on Artificial Intelligence. Darse Billings, Lourdes Pe ˜ na Castillo, ... terrain. S S AA AA AS When the settlers becomes active, chose build road. A AS SS A Use settlers or engineers to improve a terrain square within the city radius A A A SA SSSS...

Ngày tải lên: 07/03/2014, 22:20

10 508 0
Báo cáo khoa học: Peroxisomes as dynamic organelles: peroxisome abundance in yeast docx

Báo cáo khoa học: Peroxisomes as dynamic organelles: peroxisome abundance in yeast docx

... abundance in yeast FEBS Journal 277 (2010) 3279–3288 ª 2010 The Authors Journal compilation ª 2010 FEBS 3285 5 Tam YY, Fagarasanu A, Fagarasanu M & Rachubinski RA (2005) Pex3p initiates the formation ... for caveolin-1 at peroxisomes in mammalian cells [41]. Caveolin-1 is crucial for the formation of caveolae, subtypes of microdomains ⁄ rafts that are morphologi- cally recognizable...

Ngày tải lên: 15/03/2014, 23:20

10 288 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC 6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC C3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K ... (5¢fi3¢) MA(9) ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

... Experimental Evaluation The advantage of structuring the lemmatisation task as a tagging task is that it allows us to apply success- ful tagging techniques and use the context informa- tion in assigning ... accuracy known on eight European languages having different morpho- logical complexity, including agglutinative (Hungar- ian, Estonian) and fusional (Slavic) languages. 2 Lemmatisati...

Ngày tải lên: 19/02/2014, 19:20

5 456 0
Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

... Problem Siva Reddy IIIT Hyderabad India gvsreddy@students.iiit.ac .in Abhilash Inumella IIIT Hyderabad India abhilashi@students.iiit.ac .in Abstract This work models Word Sense Disam- biguation (WSD) ... deter- mined. We define the sense of a word as its vari- able. Each agent w i is associated with the variable s w i . The value assigned to this variable indicates the sense assigned by...

Ngày tải lên: 20/02/2014, 04:20

6 369 0
Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

... is defined as [(ASA of A) + (ASA of B) ) (ASA of AB dimer)] ⁄ 2. The number of water molecules in the dimer interface was detected with ASV CALCULATOR [34]. ASA was calculated with a program kindly provided ... under the accession number 3AUP. Abbreviations ANXY, Aspergillus niger xylanase; ASA, accessible surface area; AUC, analytical ultracentrifugation; BTB, back-to-back; Bg7S, basi...

Ngày tải lên: 14/03/2014, 23:20

11 524 0
w