Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

... (5¢-AAGTCCCAAAATATTATGGATATGATGGCTCGATTTCTCGAG-3¢); ELE28 (5¢-ATGAAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢-ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100(5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14-L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTGAAGGAATTTCTTTCCACCGACGCC-3¢). ... Authors Journal compilation ª 2006 FEBS 5655 Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity Lenita Viitanen1*, Matts ... polar residue His18 in A. thaliana SCP-2 is replaced by Phe17 in E. lagascae SCP-2, andthe polar residue Glu22 in E. lagascae SCP-2 isreplaced by Ala23 in A. thaliana SCP-2. E. lagascae SCP-2...

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

... Oliveira FW, Chavante SF, Santos EA, Dietrich CP& Nader HB (1994) Appearance and fate of a beta-galactanase, alpha, beta-galactosidases, heparan sulfateand chondroitin sulfate degrading ... appropriate material forthe study of intact CS chains.HexasaccharidesAlthough data from disaccharides, trisaccharides andtetrasaccharides are valuable for the detailed structuralcharacterizations ... signiﬁcant variation in compositionacross materials from diverse tissue sources, from tissues of differing ages and also within a single chain. Enhanced availability of data to facilitate thecharacterization...

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... cells from human adenocarcinomasAnna Maria Luciani1, Sveva Grande1, Alessandra Palma1, Antonella Rosi1, Claudio Giovannini2,Orazio Sapora3, Vincenza Viti1and Laura Guidoni11 Dipartimento ... arachidonic acid chains, andat 0.93–2.04 p.p.m., attributed to linolenic acid chainson the basis of a comparison with lipid extracts and from the data available in the literature, are alsoclearly ... (day)Time (day)Time (day)Time (day) A/ (Lys + Ala) c A/ (Lys + Ala) i A B A B′CFig. 5. Intensity modulation of ML signals from a representative experiment (1D and2D1H NMR data) for HeLa...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Tài liệu Báo cáo khoa học: Characterization of phycoviolobilin phycoerythrocyanin-a84-cysteinlyase-(isomerizing) from Mastigocladus laminosus pdf

... His6-PecA, His6-PecE, and His6-PecFHis-tagged PecA, E and F were puriﬁed separately by metalion chelating afﬁnity chromatography on chelating seph-arose (fast ﬂow; Amersham Pharmacia Biotech AB,according ... the activity at 45 °C being 20% less. Apparently,the lyase has a high transient at 45 °C, but also becomesmore rapidly inactivated than at 37 °C, probably byprecipitation. Because of this inactivation, ... pure addition reaction of PCB to His6-PecA was decreased 15%. However, in thiscase a small amount of the ligation/isomerization product,His6 -a- PECA, was formed (7% as compared to themaximal...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-ampliﬁed ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Thefact that the peptide was not cleaved by trypsin supports thenotion of an internal disulﬁde bond that probably resultedin a compact conformation that was resistant to cleavage.CD analysis and...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... orders of magnitude. When viewed as a whole, it is apparent that these mutations have had the most beneﬁcialeffect on the decarboxylation of 2-ketopentanoic acid.Each variant has a Kmvalue ... Again, the answer maylie with AbPPDC. It has been proposed that, ratherthan the typical Glu-Asp-His motif, AbPPDC has anAsp-Asp-His catalytic triad in which Asp282 replacesthe glutamic acid...

Báo cáo khoa học: Characterization of membrane-bound prolyl endopeptidase from brain ppt

... shown).An alternative explanation is that membrane PE isattached to membranes through a hydrophobic anchor that has been added to the protein post-translationally. A web-based (expasy) analysis of ... themembranes. Accordingly, we found that a considerableamount of PE activity bound to the membranes wasreleased upon a 0.5 m NaCl wash of total membranepreparation (Table 1). A hypotonic wash and ... prepara-tions have been analyzed and regarded as a differentpeptidase, as these preparations have shown somephysical and enzymatic features that are different from those of its classical cytoplasmic...

Báo cáo khoa học: Characterization of myo-inositol hexakisphosphate deposits from larval Echinococcus granulosus pdf

... Gui-maraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiy-ama MY Jr, Kitajima JP, Adamson RE et al. (2003)Transcriptome analysis of the acoelomate human para-site Schistosoma mansoni. Nat Genet ... furtherindebted to Ana Marı´ a Ferreira (Ca´tedra deInmunologı´ a, University of Uruguay) and her collabo-rators for experimental data that helped us optimizemetabolic labelling in the parasite, and ... Kan-azawa H & Wada Y (2000) Luminal acidiﬁcation of diverse organelles by V-ATPase in animal cells. J ExpBiol 203, 107–116.20 Alderighi L, Gans P, Ienco A, Peters D, Sabatini A &Vacca A...

Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot

... intriguing that the order of addition of tRNA and SF to the activity assay affected the tRNA-saturation curve. This suggested that SF might form a complex with unacylated tRNA in solution that hashigher ... also bementioned that it has been suggested that the 50S sub-unit may contain a domain that senses the aminoacyla-tion state of the tRNA in analogy with the T-box inantitermination of transcription ... (Fig. 7A) . This shows that the ribosomal A- site was saturated with unacylated tRNA [14] whenmaximal activation of SF occurred.Binding of tRNAPheto the A, P and E-sites of poly(U)programmed...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam