Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

... a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP + reductases Matteo de Rosa 1 , Andrea Pennati 1 , Vittorio Pandini 1 , Enrico Monzani 2 , Giuliana Zanetti 1 and Alessandro ... of the product of NADP + oxidation. Results and Discussion NADPO isolation, quantitation, and spectral characterization In order to study the kineti...

Ngày tải lên: 16/03/2014, 11:20

10 406 0
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... For each user action A t , the ASR engine produces a hypothesis ˜ A t of what the user said, drawn from a distribution Pr( ˜ A t | A t ), which is the ASR confusion model. The user state U t is ... Concretely, the val- ues of S t , U t , A t and ˜ A t are all assumed to belong to finite sets, and so all the conditional distributions in our model are mult...

Ngày tải lên: 20/02/2014, 09:20

4 471 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

... Ozawa Y, Nakamura T, Kamata N, Yasujima D, Urushiyama A, Yamakura F, Ohmori D & Imai T (2005) Thermococcus profundus 2-ketoisovalerate ferredoxin oxidoreductase, a key enzyme in the archaeal energy-producing ... donors for this key reaction [8]. POR is distributed among archaea, bacteria and anaerobic protozoa, and is a member of the 2-oxoacid oxidoreductase (OR) family, wh...

Ngày tải lên: 16/02/2014, 09:20

10 619 1
Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx

Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx

... 5¢-CAGCCGCCGTAGAA GTT GTAAGTCATCGCAAAG-3¢,5¢-CGCCGCCACCAGGG AA CATCCAGTCAATATCTAC-3, and 5¢-GCCGCCAC CAGGGAA TTGCCAGTCAATATCTAC-3¢, respectively. Confirmation of the mutated nucleotides by automated sequencing was carried ... In the case of the E315Q mutant, an additional faint band was also seen at an M r of  43 000. This band appeared as a degradation product during freezing...

Ngày tải lên: 20/02/2014, 01:20

11 593 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

... EcoRI tr-SpsB5 TA CATATGCACCATCACCATCACCATATTGTTACACCATATA NdeI pIsaA5 TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoI IsaA3Myc TA GAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRI Rao ... sequence is shown in bold. Oligonucleotide Sequence (5¢ -to3 ¢) Restriction site fl-SpsB5 TA CATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeI fl-SpsB3 TA GAATTCTTAATTTTTAGTATT...

Ngày tải lên: 07/03/2014, 01:20

13 464 0
Báo cáo khoa học: Alpha-oxidation of 3-methyl-substituted fatty acids and its thiamine dependence pptx

Báo cáo khoa học: Alpha-oxidation of 3-methyl-substituted fatty acids and its thiamine dependence pptx

... tetrahydrofolate pathway, important in one carbon-metabolism [34]. The data on aminotriazole indicate that at least in the rat the catalase pathway is of no paramount importance, and suggest that the ... had little effect on the conversion of 14 C-formate to CO 2 (but decreased the rates of a -oxidation by 90%). In rat formate is metabolized by two pathways: th...

Ngày tải lên: 08/03/2014, 02:20

9 567 0
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

... changing the target of the physiological attack [138]. The acidic component of vipoxin is a nat- ural inhibitor of the basic and catalytically active PLA 2 . In the absence of the PLA 2 -like ... non-enzy- matic subunit has a heavy chain (consisting of A1 and A2 domains) and a light chain (consisting of A3 , C1 and C2 domains) that are held together by non...

Ngày tải lên: 14/03/2014, 22:20

33 436 0
Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

... observed a change in the dis- tance from atom O28 (at the C3 atom of the pyranose ring) of this non-reducing sugar to the catalytic aspartic acid (Asp) responsible for proper orientation of the acetyl ... moved by more than 0.3 nm. Most (83.5%) of the amino acid residues are plotted in the favourable regions of the Ramachandran plot. The deviation of geomet...

Ngày tải lên: 14/03/2014, 23:20

16 429 0
Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt

Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt

... Yoshikawa T, Marat D, Doi C, Makino T, Fukuzawa K, Tsuburaya A, Satoh S, Ito T & Mits- use S (1998) Insulin resistance in cancer patients is associated with enhanced tumor necrosis factor-alpha expression ... example, in intact mitochondria and with suffi- cient availability of oxygen the rate of oxidative phos- phorylation is determined by the ATP ⁄ ADP ratio, not by the...

Ngày tải lên: 14/03/2014, 23:20

24 454 0
Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx

Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx

... conducts the deamidation reaction. However, the enzymatic characteristics of PMT have not been analyzed as a result of the lack of an easily-administered assay to detect activity of the toxin. In the present ... shown that G i2 was activated by the deamidation of Gln 205 to Glu by PMT from a cell-based assay and MS [15,16]. Ga q was also considered to be...

Ngày tải lên: 22/03/2014, 16:20

11 378 0
w