Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

... phosphorylated by a Golgi casein kinase- like kinase ex vivo and circulates as a phosphoprotein in humans Thilina Dewpura 1, *, Angela Raymond 1, *, Jose ´ e Hamelin 2 , Nabil G. Seidah 2 , Majambu ... propeptide at Ser47 as assessed by MS analysis of PCSK9 immunoprecipi- tates in the presence and absence of shrimp alkaline phosphatase (SAP). Radiola...

Ngày tải lên: 16/03/2014, 06:20

... compe- tition experiments, increasing amounts (5, 10, 50, 100 and 200-fold excess) of unlabeled visfatin–PPREwt (5¢-CAAT AC AGGGCAAAGATCATGGAAG-3¢) or visfatin–PPRE- mut (5¢-CAATAC AGGAAAAAGAAAATGGAAG-3¢) ... -dependent manner in primary human resting macrophages and in adipose tissue macrophages, but not in adipocytes. The threefold increase of visfatin mRNA was paralleled by an...

Ngày tải lên: 06/03/2014, 22:21

... used a natural language tagger which was trained on the output of ParaMor and Morfes- sor. The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s internally ... goal of measuring how the learning improves with increasing experience in terms of training set size. We want to remind the reader that our two algorithms are aimed at small...

Ngày tải lên: 20/02/2014, 04:20

... catcattatcttccggtatgagaaaatcaagcctc –R gaggcttgattttctcataccggaagataatgatg Thr317Ala – F gcctccaaaggaccaagcaaaaattacctacaaagc –R gctttgtaggtaatttttgcttggtcctttggaggc Thr317Tyr – F atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg –R ... atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg –R cagcagctttgtaggtaattttgtattggtcctttggaggcttgat Thr320Ala – F ggaccaaacaaaaattgcctacaaagctgctgcaac –R gttgcagcag...

Ngày tải lên: 17/03/2014, 09:20

... Base pairs in the duplex exhibit slide ()1.96 A ˚ ) and intermediate values for X-displacement ()3.23 A ˚ ), as in ADNA, while their inclination to the helical axis is not prominent. Major and minor ... Sundaralingam 3 and Narayanarao Yathindra 1 1 Department of Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, India; 2 Department of Chemical Sc...

Ngày tải lên: 16/03/2014, 18:20

... the putative promoters of caspase-1, caspase-8 and caspase-10, and increase their expressions. In turn, increased pro-caspase-8 is recruited to HIPPI–HIP-1 heterodimer and increases apoptosis. The ... apoptosis by exogenous HIPPI in the presence of endogenous HIP-1 is mediated through activation of caspase-8, caspase-1, caspase-9 ⁄ caspase-6, and caspase-3. Cleavage of Bid...

Ngày tải lên: 23/03/2014, 07:20

... (forward 5¢-GAGATTGCACCACTGC GCTCTA-3¢, reverse 5¢-AGCCAGAATGTCCCGTCAA AAA-3¢) as a negative control. Statistical analysis All values for the luciferase activity assay are means ± SEM. Data were analyzed ... atf3-sense, 5¢-GGTTTGCCATCCAGAACAAG-3¢; atf3-antisense, 5¢-CC TCCCAGGAGAAGGTAAGC-3¢; adipor2-sense, 5¢-TAGC CTTTGGTTTGCTTTGG-3¢; adipor2-antisense, 5 ¢-CATAT CTCCAGGCGTCAACC-3¢; gapdh...

Ngày tải lên: 22/03/2014, 21:21

... chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also conserved 98 kDa M Wt Insoluble Total cell lysate Periplasm Membrane Cytoplasm kDa M Wt Insoluble Total ... conditions is not understood. Anal- ysis of insertional mutagenesis and complementation work in Pseudomonas aeruginosa, Pseudomonas fluores- cens, Paracoccus denitrificans and Pseudomonas...

Ngày tải lên: 15/02/2014, 01:20

... of approaches to treat elastin- degrading diseases, the aim of this study was to investigate the degradation of the natural substrate tropoelastin by the elastinolytic matrix metallopro- teinases ... metalloproteinase degradation of elastin, type IV collagen and proteoglycan. A quantitative com- parison of the activities of 95 kDa and 72 kDa gelatin- ases, stromelysins-1 and -2 and...

Ngày tải lên: 16/02/2014, 14:20

... Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI. Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding site, but lack an inde- pendent ... The Authors Journal compilation ª 2010 FEBS bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used...

Ngày tải lên: 16/02/2014, 14:20