0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

... phosphorylated by a Golgi casein kinase- like kinase ex vivo and circulates as a phosphoprotein in humans Thilina Dewpura1,*, Angela Raymond1,*, Jose´e Hamelin2, Nabil G. Seidah2, Majambu ... propeptide at Ser47 as assessed by MS analysis of PCSK9 immunoprecipi-tates in the presence and absence of shrimp alkalinephosphatase (SAP). Radiolabeling and site-directedmutagenesis also demonstrated ... The Authors Journal compilation ª 2008 FEBSendogenous inhibitor, a catalytic domain characteristicof serine proteases and a C-terminal Cys- and His-richdomain implicated in enzyme stability and...
  • 14
  • 454
  • 0
Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf

Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf

... compe-tition experiments, increasing amounts (5, 10, 50, 100 and 200-fold excess) of unlabeled visfatin–PPREwt (5¢-CAATACAGGGCAAAGATCATGGAAG-3¢) or visfatin–PPRE-mut (5¢-CAATACAGGAAAAAGAAAATGGAAG-3¢) ... -dependent manner in primaryhuman resting macrophages and in adipose tissue macrophages, but not in adipocytes. The threefold increase of visfatin mRNA was paralleled by anincrease of protein expression ... rosiglitazone on visfatin and adiponectin plasma concentrations in patients with type2 diabetes and coronary artery disease. Clin Lab 54,237–241.45 Varma V, Yao-Borengasser A, Rasouli N, Bodles AM,Phanavanh...
  • 13
  • 565
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... used a natural language tagger which wastrained on the output of ParaMor and Morfes-sor. The goal was to mimic each algorithm sinceParaMor is rule-based and there is no access toMorfessor’s internally ... goal of measuring how the learningimproves with increasing experience in terms oftraining set size. We want to remind the reader thatour two algorithms are aimed at small datasets.We randomly ... and Bain, 1999), connectionist methods (Rumelhart and McClelland, 1986; Gasser, 1994) or statisti-cal or probabilistic methods (Harris, 1955; Hafer and Weiss, 1974). Another way of classifying ap-proaches...
  • 9
  • 557
  • 0
Báo cáo khoa học: Transport of taurocholate by mutants of negatively charged amino acids, cysteines, and threonines of the rat liver sodium-dependent taurocholate cotransporting polypeptide Ntcp docx

Báo cáo khoa học: Transport of taurocholate by mutants of negatively charged amino acids, cysteines, and threonines of the rat liver sodium-dependent taurocholate cotransporting polypeptide Ntcp docx

... catcattatcttccggtatgagaaaatcaagcctc–R gaggcttgattttctcataccggaagataatgatgThr317Ala – F gcctccaaaggaccaagcaaaaattacctacaaagc–R gctttgtaggtaatttttgcttggtcctttggaggcThr317Tyr – F atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg–R ... atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg–R cagcagctttgtaggtaattttgtattggtcctttggaggcttgatThr320Ala – F ggaccaaacaaaaattgcctacaaagctgctgcaac–R gttgcagcagctttgtaggcaatttttgtttggtccThr320Tyr – F ccaaaggaccaaacaaaaatttactacaaagctgctgcaactgagg–R ... ccaaaggaccaaacaaaaatttactacaaagctgctgcaactgagg–R cctcagttgcagcagctttgtagtaaatttttgtttggtcctttggFLAG(R)-insert – F Ggtcagatggcaaatgattacaaggatgacgacgataagtagaatgtgaaacttcgaagc–R GcttcgaagtttcacattctacttatcgtcgtcatccttgtaatcatttgccatctgaccÓ...
  • 11
  • 367
  • 0
Báo cáo khoa học: Solution structure of 2¢,5¢ d(G4C4) Relevance to topological restrictions and nature’s choice of phosphodiester links docx

Báo cáo khoa học: Solution structure of 2¢,5¢ d(G4C4) Relevance to topological restrictions and nature’s choice of phosphodiester links docx

... Base pairs in the duplex exhibit slide ()1.96 A ˚) and intermediate valuesfor X-displacement ()3.23 A ˚), as in ADNA, while theirinclination to the helical axis is not prominent. Major and minor ... Sundaralingam3 and Narayanarao Yathindra11Department of Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, India;2Department of ChemicalSciences, TIFR, Colaba, ... model was subjected to restrainedenergy minimization using the conjugate gradient algorithm and was guided by the experimental NOE distance restraints as well as dihedral restraints. A conform ational...
  • 11
  • 404
  • 0
Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... the putativepromoters of caspase-1, caspase-8 and caspase-10, and increase their expressions. In turn, increased pro-caspase-8 is recruited to HIPPI–HIP-1heterodimer and increases apoptosis. The ... apoptosis by exogenous HIPPI in the presence of endogenous HIP-1 is mediatedthrough activation of caspase-8, caspase-1, caspase-9 ⁄caspase-6, and caspase-3. Cleavage of Bid and releaseof cytochrome ... of apoptosis. In the ‘intrinsic pathway’,signal factors released from mitochondria activatecaspase-9 and then caspase-3, leading to cell death.These two pathways may crosstalk via caspase-8-medi-ated...
  • 9
  • 492
  • 0
Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf

Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf

... (forward 5¢-GAGATTGCACCACTGCGCTCTA-3¢, reverse 5¢-AGCCAGAATGTCCCGTCAAAAA-3¢) as a negative control.Statistical analysisAll values for the luciferase activity assay are means ±SEM. Data were analyzed ... atf3-sense,5¢-GGTTTGCCATCCAGAACAAG-3¢; atf3-antisense, 5¢-CCTCCCAGGAGAAGGTAAGC-3¢; adipor2-sense, 5¢-TAGCCTTTGGTTTGCTTTGG-3¢; adipor2-antisense, 5 ¢-CATATCTCCAGGCGTCAACC-3¢; gapdh-sense, 5¢-ATGACATCAAGAAGGTGGTG-3¢; ... bromide-stained bands wasanalyzed using an i-MAX gel image analysis system (Core-BioSystem, Seoul, Korea) and Alpha EasyÔ FC software(Alpha Innotech, San Leandro, CA, USA). The relation-ship...
  • 14
  • 303
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... chelatase and dehydrogenase function [17];interestingly, this aspartate, Asp129, is also conserved98kDaM WtInsolubleTotal cell lysatePeriplasmMembraneCytoplasmkDaM WtInsolubleTotal ... conditions is not understood. Anal-ysis of insertional mutagenesis and complementationwork in Pseudomonas aeruginosa, Pseudomonas fluores-cens, Paracoccus denitrificans and Pseudomonas stutzerihave ... DnirFstrain expressing plasmid-encoded nirF. In addition,expression of plasmid-encoded strep II-tagged nirF wasdemonstrated by western blot analysis with alkalinephosphatase-conjugated strep-tactin antibody...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

... of approaches to treat elastin-degrading diseases, the aim of this study was to investigate the degradationof the natural substrate tropoelastin by the elastinolytic matrix metallopro-teinases ... metalloproteinase degradation of elastin,type IV collagen and proteoglycan. A quantitative com-parison of the activities of 95 kDa and 72 kDa gelatin-ases, stromelysins-1 and -2 and punctuatedmetalloproteinase ... necrosis factor -a and a 2-macro-globulin [2]. MMP-9 (gelatinase B) is secreted by neu-trophils and macrophages and has also been found in various malignant cells, ras-transformed murine cells,and...
  • 18
  • 428
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI. Boththe PDI a domain and DsbA have a catalytic site, withan associated substrate-binding site, but lack an inde-pendent ... The Authors Journal compilation ª 2010 FEBSbacitracin contains at least nine different peptides, ofwhich bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections ... medicinally to prevent infections in smallcuts and burns and to treat gastrointestinal infections. In addition, it is used as an animal feed additive fordisease prevention and growth promotion in...
  • 9
  • 620
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ