Báo cáo khoa học: S-nitrosylated proteins of a medicinal CAM plant Kalanchoe pinnata – ribulose-1,5-bisphosphate carboxylase⁄oxygenase activity targeted for inhibition pot

... FEBS S-nitrosylated proteins of a medicinal CAM plant Kalanchoe pinnata – ribulose-1,5-bisphosphate carboxylase ⁄ oxygenase activity targeted for inhibition Jasmeet K. Abat 1 , Autar K. Mattoo 2 and Renu ... botanical garden at the University of Delhi, India. The third pair of leaves from the apex was excised and used for the S-nitrosylated proteins...

Ngày tải lên: 16/03/2014, 06:20

... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. capsulatus O. A. Karlsen ... 148, 16 9–1 74. 16 Feldman RA, Wang E & Hanafusa H (1983) Cytoplas- mic localization of the transforming protein of Fujinami sarcoma virus: salt–sensitive association with subcellular c...

Ngày tải lên: 23/03/2014, 11:20

... interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 ... Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran conformations of amino acid residues in protein structures. J Mol Biol 264, 19 1–1 98. 46 Jia Z, Vandonsel...

Ngày tải lên: 18/02/2014, 11:20

... nacreous layer formation of Pinctada fucata. FEBS Lett 462, 22 5–2 29. 5 Kono M, Hayashi N & Samata T (2000) Molecular mechanism of the nacreous layer formation in Pinctada maxima. Biochem ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonite c...

Ngày tải lên: 18/02/2014, 17:20

... the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–1 2 min after initiation of the reaction. The spectral ... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic a...

Ngày tải lên: 19/02/2014, 05:20

... helices (a9 – a1 0 a1 6 a1 7). Helices a1 2 a1 3 a1 4 a2 0 are placed at the dimer interface. Domain III, residues 43 4–4 69, is assigned as the tail domain. A single helix a2 1, and two short b strands, b9–b10, ... 25% of the accessible surface area of a monomer contributes to Ll PDH dimer formation. Whereas LlPDH and OaPDH have a buried surface area of  5500 A ˚ 2 ,...

Ngày tải lên: 19/02/2014, 05:20

... activities of a catalytic antibody with a peroxidase activity Formation of Fe(II)–RNO complexes and stereoselective oxidation of sulfides Re ´ my Ricoux, Edyta Lukowska, Fabio Pezzotti and Jean-Pierre ... hydroxyl- amines was examined. This constituted a new reaction for hemoabzymes and is the first example of fully characterized Fe(II)–metabolite complexes of antibody–porph...

Ngày tải lên: 19/02/2014, 12:20

... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The lability of the a- proton observed ... that involvement of a water (D 2 O) molecule may ensure the formation of a favorable six-membered transition state (Fig. 4). Such a mechanism m ight be facil...

Ngày tải lên: 19/02/2014, 16:20

... uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59, 135 7–1 365. 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser ... novel statistical quantity for assessing the accuracy of crystal structures. Nature 355, 47 2–4 75. 76 McRee DE (1999) xtalview ⁄ xfit – A versatile program for manipulating a...

Ngày tải lên: 19/02/2014, 16:20

... system. Also, their underlying task (air travel domain) is much simpler than our tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual ... technical support (Acomb et al., 2007), medication assistance (Allen et al., 2006)). These domains bring forward new challenges and issues that can affect the usability of such systems: in...

Ngày tải lên: 20/02/2014, 12:20