... [19]. In mammalian apop- tosis, caspase-8 and caspase-9 are known to be associ- ated with the mitochondrial pathway. Active caspase-8 induces the release of mitochondrial apoptosis factors, in a ... of apoptosis, which is separate from the caspase pathway mentioned above. By analogy, it is reasonable to assume that mitochondria play a key role in PND in Tetrahymena. Unfortunatel...
Ngày tải lên: 20/02/2014, 03:20
... purposes. A hardware approach hasn't been tried in the natural language processing field yet. The authors propose developing natural lan- guage parsing accelerators, a hardware approach to ... 0 .44 Figure lh Implementation Time Comparison for 5,000 Character Japanese Text toward achieving natural language parsing accel- erators, which is a new approach to speeding up...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc
... 4 Information Structure and Tactical Constraints Entries in the eategorial lexicon have tactical con- straints, grammatical and semantic features, and phonological representation. Similar ... elling interactions between different levels of lan- guage analysis. In agglutinative languages, affixes are attached to stems to form a word that may cor- respond to an entire phrase in...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: A short-chain dehydrogenase involved in terpene metabolism from Zingiber zerumbet pptx
... ¢-GATAC ACGGGGGCAGCACATGCTGTAGTAG-3¢, and K15 9A reverse, 5¢-CTACTACAGCATGTGCTGCCCCCGTGTAT C-3¢; S 14 2A forward, 5¢-CTATAGTCTCCCTGGCCGCA GTATCTTCTGTGATTG-3¢, and S 14 2A reverse, 5¢-CAAT CACAGAAGATACTGCGGCCAGGGAGACTATAG-3¢; S 14 4A ... using a prime star HS DNA polymerase (Takara Bio, Ohtsu, Japan) with a pair of oligonucleotide primers (5¢-ATGAGGTTAGA AGGGAAAGTTGC-3¢ and 5¢-TTCGA...
Ngày tải lên: 28/03/2014, 22:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAAC...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
... labelled information for training. Our sys- tem extracts transliteration pairs in an unsupervised fashion. It is also able to utilize labelled information if available, obtaining improved performance. We ... Wikipedia InterLan- guage Links (WIL) data. The NEWS10 dataset con- tains 1000 labelled examples (called the “seed data”) for initial training. All systems which participated in t...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A Gibbs Sampler for Phrasal Synchronous Grammar Induction" docx
... using small train- ing corpora and constraining the search space using a word-alignment model or parse tree. None of these limitations are particularly desirable as they bias inference. As a ... expressive grammars would be a straightforward extension of our model. 3 Related work Most machine translation systems adopt the approach of Koehn et al. (2003) for ‘training’ a phrase-based...
Ngày tải lên: 20/02/2014, 07:20
Tài liệu Báo cáo khoa học: "A Modular Toolkit for Coreference Resolution" pdf
... optimization code, with a function for programmatic feature combination. 2 Training/Testing The training and testing phases slightly differ from each other. In the training phase, the pairs that are ... visual display). Preprocessing consists in marking up noun chunks and named entities, as well as additional in- formation such as part-of-speech tags and merging these information in...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt
... indicates the fraction of sentences that have a complete cor- rect analysis. We also measure that root accuracy (RA) and leaf accuracy (LA), as in (Yamada and Matsumoto, 2003). When evaluating the result, we ... are computed and search is called again. One interesting property of this framework is that it allows that use of future information in ad- dition to past information. The pipel...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... understanding problems versus lack of items in the database. This has to be balanced against degradation in accuracy resulting from in- creasing the vocabulary. In practice we found that users, ... speech inputs, word accuracy was 44 % and sentence accuracy 38%. In the tablet condition, word accuracy averaged 46 % and sentence accu- racy 41 %. In the remote control conditio...
Ngày tải lên: 20/02/2014, 12:20