Báo cáo khoa học: Role of active-site residues of dispersin B, a bioﬁlm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... chitinases are retaining glycosidehydrolases that have been found in many organisms varying from bacteria to humans [1,2]. The catalytic domains of family 18 chitinases have a (ba)8(TIM barrel) ... Asp140,whichappearstobecrucialinChiBandinchitinaseA1 from Bacillus circulans, whereas it may be mutated toasparagine without loss of activity in other family 18chitinases [28,30]. Preliminary results of ... theglutamate that acts as the catalytic acid. The active sitegrooves of these chitinases are lined with aromatic aminoacids that contribute to substrate binding [6,11].Catalysis in retaining glycoside...

Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

... 5¢-GCCACTTACTTGAACTTTGACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGCATTTGACATAGAAGCC-3¢,5¢-GCCACTTACTTGGACTTTAACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGACTTTGCGATAGAAGCCGG-3¢,5¢-GGACTTTGACATACAAGCCGGTATCGATGC-3¢,5¢-GGACTTTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGATCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, ... 670–680.29 Mine S, Nakamura T, Hirata K, Ishikawa K,Hagihara Y & Uegaki K (2006) Crystallization andX-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus ... Watanabe T, Ariga Y, Sato U, Toratani T, HashimotoM, Nikaidou N, Kezuka Y, Nonaka T & Sugiyama J(2003) Aromatic residues within the substrate- bindingcleft of Bacillus circulans chitinase...

Báo cáo khoa học: Role of active-site residues of dispersin B, a bioﬁlm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

... ForwardCCACAGAATAACCAAATTGATCGCCACC ReverseY18 7A GATGAATTTGGTGCGTCTGTGGAAAG ForwardCTTTCCACAGACGCACCAAATTCATC ReverseW23 7A CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG ForwardCGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG ... 5999 Role of active-site residues of dispersin B, a bioﬁlm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis Suba G. A. Manuel, Chandran Ragunath, Hameetha B. R. Sait, ... ForwardCGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG ReverseY27 8A CCTATTATCTTGCGATTGTTCCGAAAGC ForwardGCTTTCGGAACAATCGCAAGATAATAGG ReverseW330Y GCAGCATTATCGATCTACGGAGAAGATGC ForwardGCATCTTCTCCGTAGATCGATAATGCTGC ReverseE332Q...

Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

... ﬁndings suggest that ablation of KCsprotects against hepatic drug-metabolizing dysfunction by modulation of the in ammatory response.AbbreviationsALT, alanine aminotrasferase; AST, aspartate ... expression and activity of CYP2E1 weredownregulated in a rat hepatoma cell line after theadministration of proinﬂammatory cytokines, leadingto a loss of catalytic activity. This downregulation wasat ... which was signiﬁcantly attenuated byGdCl3. Similar to the ALT level, the serum aspartateaminotransferase (AST) level increased signiﬁcantly at24 h after CLP and this increase was attenuated...

Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

... several adhesins such as BabA, BabB, SabA, AlpA and AlpB, as well as OipA, which mediate apical binding of the bacteria (1).Attached H. pylori or those in the mucus secrete virulence factors into ... restricted areas before a limited number of bacteria gain access to integrins and inject CagA. Thebasal injection model of CagA can also explain whyH. pylori does not cause more gastric damage in infected ... CagA in the EPIYA-motifs, inhibition of Src by CagAPYgenerates a classical negative feedback-loop that appears to control the amount of intracellu-lar CagAPY. Cortactin, ezrin and vinculin...

Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt

... 5¢-GTAGGCATGAGAACGGGAAG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGAAA-3¢ and for CERK-negative forward 5¢-CCGCAAGAGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGACACGGAGAT-3¢, as a negative control ... Biotechnology (LakePlacid, NY, USA). A MEBCYTO Apoptosis Kit waspurchased from Medical and Biological Laboratories(Nagoya, Japan), and a Nuclear Extract Kit was from Active Motif (Carlsbad, CA, USA). ... was purchased from Perkin-Elmer (Boston, MA, USA) and a lipofectamine2000 reagent was from Invitrogen (Carlsbad, CA, USA).Dual-Luciferase reporter assay system was purchased from Promega (Madison,...

Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidiﬁcation and cathepsin D in cholera toxin cytotoxicity pdf

... determination,enzyme assays and materialsCT -A and CT -B, native CT, acridine orange and pepsta-tin A were purchased from Sigma (St Louis, MO, USA). A nontoxic diphtheria toxin CRM 197 mutant and baﬁlomy-cin -A1 ... obtained from Calbiochem (San Diego, CA,USA). Rabbit polyclonal anti-(CT C3062) was obtained from Sigma. Rabbit polyclonal IgG directed against Gsaproteins was obtained from NEN. Rabbit anti-(mousecathepsin ... CT increased endosomal acidiﬁ-cation at the early stage of CT action. Role of endosomal acidiﬁcation and cathepsin D in CT actionTo assess whether the aspartic acid protease cathep-sin D and...

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... intracellular signaling pathways[17,18]. Activation of tyrosine kinase receptors isinvolved in cell survival through downstream signalingcascades such as the MAP kinase and phosphatidyl-inositol-3¢-OH ... growth factor transmitted protective signals against ADR-inducedapoptosis by causing activation of the phosphatidylinositol-3¢ -OH kinase(PtdIns3-K) ⁄ Akt signaling pathway in human epithelial cell ... 6A) . Because TAM67 lacks thetransactivation domain of c-Jun (amino acids 1–122),but retains the DNA binding and leucine-zipper region of c-Jun, it should function as a dominant-negativemutant...

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by ﬂuorescence resonance energy transfer and the role of ATP hydrolysis pptx

... strand exchange assay weresynthesized by Metabion (Martinsreid, Germany) with thefollowing sequences: PhiC: 5¢-CGATACGCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAGGGTAATAAGAACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢and ... 5¢-CGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGACAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. Phi-Cand Phi-W were complementary to each other. Phi-C waslabeled ... CM(1997) Activities of human recombination proteinRad51. Proc Natl Acad Sci USA 94, 463–468.24 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K,Miyagawa K, Shibata T, Kurumizaka H & YokoyamaS (2004)...

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

... with a modiﬁcation in the mathematicalprocessing of the raw data, as previously described [48].The measurements were performed at 25 °C in NaCl ⁄ Picontaining 1% BSA. Fab4E11-H6 at a constant ... kineticdata were analysed with the biaevaluation 3.0 software(Biacore). The active concentration of each Fab4E11-H6preparation was determined as described [50]. Brieﬂy, 500RU of MalE-E3-H6 was captured ... mutagen-esis of their residues into alanine (Ala scanning). Theafﬁnities of the puriﬁed mutant Fab fragments of mAb4E11 for its antigen were measured by a competi-tion ELISA in solution, and...

Xem thêm