Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

... (5¢-TCCCGTGTGTGCAGACCATCTTGAAT -3 ), H528A forward primer(5¢-TCCCGTGTGTCAAGACGCTCTTGAAT -3 ) or H 52 8Sforward primer (5¢-TCCCGTGTGTCAAGACTCTCTTGAAT -3 ) and reverse primer (5¢-AGTCCCGGGGTGTTCATGTATGCTC -3 ). ... thisis not considered to be of great importance and couldbe a result of differences in the active enzyme concen-tration.The effect of changing residues in the helicase domain on inhibition was ... practical reasons, most researchersworking on the discovery of drugs against either of theKeywordsfull length; hepatitis C virus; inhibition; nonstructural protein 3; protease CorrespondenceU....

Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx

... discourse; information on the position and on the whole sentence can be extracted from each occurrence of CFRAME. In accumulating discourse informa- tion, a score of 1.0 is awarded for each ... discourse information, and give the results of an experiment on completing incomplete parses in technical documents. 2 Discourse information for completing incomplete parses In this section, ... PP=preposition DET=determiner ".°, Figure 4: Constructing a dependency structure by combining dependencies existing within phrases that occur in other sentences of the same chapter in the discourse...

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several speciﬁc biological processes through GCN2-dependent and GCN2-independent pathways ppt

... forward, CCTATGAGCACCTGACCACAreverse, AGGCCACTGACTAGGCTGAAEgr1pre-mRNAforward, GAGCAGGTCCAGGAACATTGreverse, GGGATAACTCGTCTCCACCANdrg1 forward, ACCTGCTACAACCCCCTCTTreverse, TGCCAATGACACTCTTGAGCIdi1 ... forward, CCTTGCCCTACAGCTGAGTCreverse, CTTGTCTTCTGTGCCTGTGCIfrd1 forward, GTTTGAATTGGCCAGAGGAAreverse, TCTGTTGGAAAATCCCGTTCCxcl10 forward, CCCACGTGTTGAGATCATTGreverse, GAGGAACAGCAGAGAGCCTCCxcl10pre-mRNAforward, ... 3. Primers used for quantitative RT-PCR.Primer (5¢-to3¢)Ddit3 (Chop) forward, CCTAGCTTGGCTGACAGAGG;reverse, CTGCTCCTTCTCCTTCATGCAsns forward, TACAACCACAAGGCGCTACA;reverse, AAGGGCCTGACTCCATAGGTTrb3...

Báo cáo khoa học "ADIABATIC TEMPERATURE RISE AND REACTION RATE OF MASS STRUCTURE IN LOTTE CENTER HANOI PROJECT " pptx

... thermal convection from surface after concrete placing was adopted. Table 4 demonstrates the applied section, method of concrete curing, and curing periods. According to the table applied curing ... delayed concrete and the rest of section was placed by normal concrete. The method of curing concrete is demonstrated in 3. 3 and shown in Figure 6. Figure 6. Shape and curing plan of mat ... of adiabatic temperature rise and reaction velocity of the real member Class. Temp. of concrete placing Temp. increased Reaction velocity Mock-up Test 32 ℃ -35 ℃ 44 .3 1.15 The First Full-Scale...

Báo cáo khóa học: O-acetylation and de-O-acetylation of sialic acids in human colorectal carcinoma docx

... eﬀected by incu-bation with cytosolic fraction).Table 2. Reduction in glycoconjugate bound Neu5,9Ac2and oligo-O-acetylated Neu5Ac in cancer mucosa at various stages of colorectal carcinoma.Sialic ... oligo-O-acetylation with mono-O-acetylation remaining constant [7 ,30 ]. In this study, utilizing matched colonic samples (resection margin and cancertissue obtained from the same colorectal carcinomapatients) ... surgicalresection of colorectal carcinomas. Fresh resection margintissue, which showed normal histology, was obtained fromthe excised end of colon tissue resected for carcinoma. Thecolorectal carcinoma...

Báo cáo khoa học: Val216 decides the substrate speciﬁcity of a-glucosidase in Saccharomyces cerevisiae doc

... cloning into plasmid pKP1500. Theforward p rimer 5¢-ATGACTATTTCTTCTGCACATCCAGAGACAGAAC -3 con tains the initiation codon,while the reverse primer 5¢-CTTTCTGCAGACTCATTCGCTGATATATATTC -3 linked ... c onstructed by arecombination o f the N-terminal fragment containingconsensus region I of isomaltase and maltase, respectively.The recombination had no effect on either the substratespeciﬁcities ... in consensus region II must b e involved in the recognition of a-glucosidic linkages. In conclusion, this work was successful in identifying theregion and residue important in the determination of thesubstrate...

... ﬁrst is a selection of data from CoNLL-2004 and contains 8 936 sentences. The seconddataset is part of the Lancaster Treebank corpusand contains 14 73 sentences. Each sentence con-tains hand-labeled ... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 120–127,Sydney, July 2006. c 2006 Association for Computational LinguisticsTechniques to incorporate the beneﬁts of ... withinthe sentence. The clauses can be embedded in other clauses but cannot overlap one another.Furthermore each clause contains one or moretext chunks.Consider a sentence from a CoNLL-2004 cor-pus:(S...

Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf

... 5¢-ACTGGCGGCCGCTCGAG -3 withone of the sense primers AR2P()870), AR2P( )34 3) orAR2P()72) (5¢-GGTACCTTCCCCCTCCTACTGAATGT -3 ,5¢-GGTACCCCTCCTCCTCAGCTCCAAAT -3 and5¢-GGTACCTCGTGGGGGCGGGGAGA -3 , ... [c- 32 P]dATP (sense 5¢-GTGCGATGCGCGTCACGGCGA -3 ; antisense 5¢-TCGCCGTGACGCGCATCGCAC -3 ). Labeled probes werethen incubated with 5 mg of nuclear extract protein in thepresence or absence of ... pairsequences were 5 ¢-AGCACACGGTGAACTGTTCCAGAGG -3 and 5¢-ACTTCTTGGGAGCCACCGCTGAG- 3 . A series of deletion constructs of the AdipoR2 promoterwere PCR-generated using pairwise combinations of theantisense...

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

... N-myristoylated proteins include protein kinases, phosphatases, guanine nucleotide-bindingproteins, and Ca2+-binding proteins, many of whichparticipate in signal transduction pathways [1,4–7]. Protein ... position 3 for N-myristoylation (Fig. 5B). In the case of Myr–AGG1-3X6S7K, [14 C] myristic acid incorporation wasdetected in all constructs, with the exception of thosewith Pro3 or Asn3 (Fig. 5C) , ... conditions recommended by the manufacturer [38 ]. The batchwise reaction mixture (25 lL) containedwheat germ extract (ﬁnal concentration, 60 A260 nmunits),4.7 lL of reaction buffer, creatine...

Tài liệu Báo cáo khoa học: Mixed-type noncompetitive inhibition of anthrax lethal factor protease by aminoglycosides ppt

... concentration; FRET, ﬂuorescence resonanceenergy transfer; [I], inhibitor concentration; KðappÞi, apparent inhibition constant; Ki, competitive inhibition constant; Kis, inhibition constant;MAPKKide, ... 2. Inhibition of the lethal factor (LF) protease by neomycin B:ionic strength (I.S.) effects on the apparent inhibition constant. Theapparent inhibition constants Ki(app)were determined by ... charge in the active site of acetylcholine esterase [8] and porcine pepsin [7].Nolte et al. [8] studied ionic-strength effects on the inhibition of acetylcholine esterase by N-methylacri-dinium...

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ