0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

... 3177–3182.4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H,Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion ... Journal 274 (2007) 4719–4730 ª 2007 The Authors Journal compilation ª 2007 FEBS Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 Laura ... anemia virus, the animalpathogen of the Circoviridae family, and is currently classified as a member of a new, floating genus, Anellovirus. Molecular and cell biological researchon TTV has been...
  • 12
  • 446
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... pointbetween agonist and antagonist structures [21–23].By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAla-NHMe have been generated and compared to ... varying /, wangles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10°.Each/, h,andw-value was fixed by applying a harmonic potential and the structures were minimized(adiabatic ... solvent variation, causing an under-estimation of calculated CSDs. These CSDHa and CSDCavariations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for...
  • 11
  • 860
  • 0
Báo cáo khoa học: Analysis and biological relevance of advanced glycation end-products of DNA in eukaryotic cells ppt

Báo cáo khoa học: Analysis and biological relevance of advanced glycation end-products of DNA in eukaryotic cells ppt

... were asfollows: b-actin – hsbact-S3-391 (5¢-TGA GAC CTT CAACAC CCC AG-3¢) and hsbact -A5 -10 46 (5¢-CAT CTG CTGGAA GGT GGA CA-3¢); b-galactosidase – b_Gal_F (5¢-AAT CGT CTG ACC GAT GAT CC-3¢) and ... byDNA-advanced glycosylation endproducts. Proc NatlAcad Sci USA 90, 266 6– 267 0.28 Murata-Kamiya N, Kamiya H, Kaji H & Kasai H(1997) Glyoxal, a major product of DNA oxidation,induces mutations ... CC-3¢) and b_Gal_R(5¢-CGG ATA AAC GGA ACT GGA AA-3¢); and lucifer-ase – Luci_F (5¢-TAT CCG CTG GAA GAT GGA AC-3¢) and Luci_1R (5¢-TTT CTT GCG TCG AGT TTT CC-3¢).Samples of 250 ng were amplified...
  • 12
  • 381
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI ... core of the pro-tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.58 56 FEBS ... have maximal activity towards pNPP at an acidic pH, around 5.5, and Tt SurEwas maximally active at pH 8.2. St SurE shows almostno activity in the absence of divalent metal ions. Activa-tion...
  • 10
  • 553
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel-opment (blastula, gastrula, trochophore larvae, D lar-vae, 7 and ... each node.Isolation and characterization of Cg-BMPR1 and Cg-TGFbsfR2 TGFb genes A C. gigas genomic library was constructed in kDASH II(Stratagene, La Jolla, CA, USA). A total of 1.8 · 10 6 inde-pendent ... melanogaster(AAC41 566 ), Saxophone D. melanogaster (I45712), Thick vein D. melanogaster (XP_07 968 9), Wishful thinking D. melanogaster (AAF60175),ALK-1 Ephydatia fluvatilis (BAA8 260 1), ALK-2 E. fluvatilis...
  • 17
  • 508
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Computing and Evaluating Syntactic Complexity Features for Automated Scoring of Spontaneous Non-Native Speech" pot

... (CB features); and (2) Parse Tree based features (PT features). Clause based features are based on both clause boundaries and clause types and can be generated from human clause annotations, ... im-portant aspects of spontaneous speech which are relevant to be evaluated both by a human rater and an automated scoring system. Examples of such aspects of speech, which are considered part of ... Pearson correlation coeffi-cient with human scores was larger than 0.2; and (2) the mean value of the feature on non-native speakers was at least 20% lower than that for na-Name Type8Meaning...
  • 10
  • 453
  • 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... [ 56] . The mutant BCR–ABL tyro-sine kinase activates several signalling pathways, includ-ing the ERK1 ⁄ 2 pathway, the PKB pathway and theJanus kinase ⁄ signal transducer and activator of tran-scription ... 2–ERK1 ⁄ 2 pathway and show similaroral activity, with AZD6244 undergoing clinical evalu-ation at the time of writing. AZD6244 can cause a G1cell cycle arrest and in some cases apoptosis; mousexenograft ... Bcl-2 family that promotes apoptosis.EMBO J 17, 384–395. 6 U M, Miyashita T, Shikama Y, Tadokoro K &Yamada M (2001) Molecular cloning and characteriza-tion of six novel isoforms of human Bim,...
  • 13
  • 453
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

... gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent ways: as an unstructured ( ) and a structured ... ed. ac.uk Abstract We apply Smith's theory of aspect (1991) to German - a language without any as- pectual markers. In particular, we try to shed more light on the effects aspect can...
  • 3
  • 254
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Nina A. Kocharova2, George V. Zatonsky2, Danuta Witkowska1, Maria Bogulska1,Alexander S. Shashkov2, Andrzej Gamian1 and Yuriy A. Knirel21L. Hirszfeld Institute of Immunology and ... Citrobacter strains and tosubstantiate multiple cross-reactions between Citrobacter and other genera of the family Enterobacteriaceae,suchasHafnia, Escherichia, Klebsiella and Salmonella [6] . Now wereport ... loss of ara4dHex, but nodestruction of the other monosaccharides. Methylationanalysis of OPS-I and OPS-II by GLC-MS of the partiallymethylated alditol acetates (Table 1) revealed terminalara4dHex,...
  • 7
  • 478
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

... USAjonask@mail.utexas.eduAbstractThis paper proposes the application of finite-state approximation techniques on a unification-based grammar of word for-mation for a language like German. A refinement of an ... model of word formation,there are a number of considerations that speak infavor of a finite-state account. (A basic assumptionmade here is that a morphological analyzer is typi-cally used in a ... upthe planning of traffic routes’) appear in corpora. So,for a fully adequate and general account, the token-level analysis in German has to be done at least with a context-free grammar:1For...
  • 8
  • 353
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ