Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

... 3177–3182. 4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion ... Journal 274 (2007) 4719–4730 ª 2007 The Authors Journal compilation ª 2007 FEBS Construction and biological activity of a full-length molecular clone of...

Ngày tải lên: 16/03/2014, 05:20

12 446 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... point between agonist and antagonist structures [21–23]. By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b 2 -HAla-NHMe and Ac-b 3 -HAla- NHMe have been generated and compared to ... varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10°.Each/, h,andw-value was fixed by applying a harmonic potential and the structures...

Ngày tải lên: 08/03/2014, 08:20

11 861 0
Báo cáo khoa học: Analysis and biological relevance of advanced glycation end-products of DNA in eukaryotic cells ppt

Báo cáo khoa học: Analysis and biological relevance of advanced glycation end-products of DNA in eukaryotic cells ppt

... were as follows: b-actin – hsbact-S3-391 (5¢-TGA GAC CTT CAA CAC CCC AG-3¢) and hsbact -A5 -10 46 (5¢-CAT CTG CTG GAA GGT GGA CA-3¢); b-galactosidase – b_Gal_F (5¢- AAT CGT CTG ACC GAT GAT CC-3¢) and ... by DNA-advanced glycosylation endproducts. Proc Natl Acad Sci USA 90, 266 6– 267 0. 28 Murata-Kamiya N, Kamiya H, Kaji H & Kasai H (1997) Glyoxal, a major product of DNA oxidatio...

Ngày tải lên: 30/03/2014, 04:20

12 381 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI ... core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium SurE A. Pappa...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel- opment (blastula, gastrula, trochophore larvae, D lar- vae, 7 and ... each node. Isolation and characterization of Cg-BMPR1 and Cg-TGFbsfR2 TGFb genes A C. gigas genomic library was constructed in kDASH II (Stratagene, La Jolla, CA, USA). A total...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
Báo cáo khoa học: "Computing and Evaluating Syntactic Complexity Features for Automated Scoring of Spontaneous Non-Native Speech" pot

Báo cáo khoa học: "Computing and Evaluating Syntactic Complexity Features for Automated Scoring of Spontaneous Non-Native Speech" pot

... (CB features); and (2) Parse Tree based features (PT features). Clause based features are based on both clause boundaries and clause types and can be generated from human clause annotations, ... im- portant aspects of spontaneous speech which are relevant to be evaluated both by a human rater and an automated scoring system. Examples of such aspects of speech, which...

Ngày tải lên: 07/03/2014, 22:20

10 453 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... [ 56] . The mutant BCR–ABL tyro- sine kinase activates several signalling pathways, includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription ... 2–ERK1 ⁄ 2 pathway and show similar oral activity, with AZD6244 undergoing clinical evalu- ation at the time of writing. AZD6244 can cause a G1 cell cycle arrest and in...

Ngày tải lên: 16/03/2014, 00:20

13 453 0
Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

... gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent ways: as an unstr...

Ngày tải lên: 17/03/2014, 09:20

3 255 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Nina A. Kocharova 2 , George V. Zatonsky 2 , Danuta Witkowska 1 , Maria Bogulska 1 , Alexander S. Shashkov 2 , Andrzej Gamian 1 and Yuriy A. Knirel 2 1 L. Hirszfeld Institute of Immunology and ... Citrobacter strains and to substantiate multiple cross-reactions between Citrobacter and other genera of the family Enterobacteriaceae,suchas Hafnia, Escherichia, Klebsiella and Salm...

Ngày tải lên: 23/03/2014, 17:22

7 478 0
Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

... USA jonask@mail.utexas.edu Abstract This paper proposes the application of finite-state approximation techniques on a unification-based grammar of word for- mation for a language like German. A refinement of an ... model of word formation, there are a number of considerations that speak in favor of a finite-state account. (A basic assumption made here is that a morphologi...

Ngày tải lên: 23/03/2014, 19:20

8 353 0
w