Báo cáo khoa học: The viral SV40 T antigen cooperates with dj2 to enhance hsc70 chaperone function docx
Tài liệu Báo cáo khoa học: The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AM1: Purification and properties docx
... revealed that the a-subunit harbours putative binding motifs for the molybdopterin cofactor and at least one iron–sulfur cluster. Sequence identity was highest to the catalytic subunits of the tungsten- ... amounts of purified FDH1 used for isolation of the pterin cofactor were not sufficient to allow quantification or the identification of the exact nature of the molybdopteri...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: The guanine nucleotide exchange factor RasGRF1 directly binds microtubules via DHPH2-mediated interaction docx
... assay did not prevent the inhibitory effect of stathmin on microtubule assembly (data not shown). Taken together, these results suggest that the DHPH2 module does not affect in vitro microtubule dynamics. Colocalization ... the cytoskeleton, the former promoting the recruitment of elements of the Rac1 signaling pathway, and the latter regulating Rho activity [47–50]. However, in...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... where the flux thro ugh the oxidative p entose phosphate pathway had to be reversed to maintain the target fluxes. Then, the NADPH needed to drive the reactions of the o xidative pathway into a ... minimum. The first part of this report briefly outlines the mathematical basis of the method. The second part presents two applications of the method to the metabolism o...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: The association of viral proteins with host cell dynein components during virus infection pdf
... viruses towards the cell Fig. 2. Viral retrograde transport model. Both the entry of the viral particle through the endosome pathway (A, C) and the direct fusion of the viral envelope to the plasma ... recent data seem to indicate that mutations in the DYNLL1 binding site within the P phosphoprotein of RV significantly attenuated viral transcription and replicatio...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... readmitted patients were excluded from the analysis. During the study period no attempt was made to alter the daily routine strategy. The study protocol was approved by the local ethics committee. During ... ICUs. Most importantly, it is not clear whether obtaining daily routine CXRs truly alters the daily management of ICU patients. There- fore, we conducted the present study...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... fusion BPPs that showed greater catalytic constants towards InsP 6 than the original enzymes. It appears that the action of PhyH-DI is general, i.e. not limited to its interaction with PhyH-DII, ... efficiencies. This is the first report to elu- cidate the substrate specificity of the incomplete domain and the functional relationship of tandemly repeated domains in BPPs. We con...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... fused to the GAL4 DNA-binding domain or the empty vector pBD, with PTI1-1 or PTI1-4 fused to the activation domain or the empty vector pAD. (B) Yeast two- hybrid assays with PTI1-4 fused to the ... root extracts after immunoprecipitation with the anti-MPK3 IgG (Fig. 6D). On the other hand, the MPK6 protein was present in root extracts after immunoprecipitation wit...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... considering the great variability in CDE nucleo- tide sequences, and the fact that functional assays with just one mutant promoter could not pinpoint this site exactly, we suggest that the site shifted ... Recently, the regulation of the BUB1B promoter was tested. The transcription factor hStaf ⁄ ZNF143 was found to be the main activator of the promoter. Furthermore, cell...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... of the Bcl-2 family involved in the initiation of apoptosis through the mitochondrial pathway. The key event in the mito- chondrial pathway is the release of proapoptotic fac- tors from the mitochondrial ... interacts with tBid, but not with Bid. Itch ubiqui- tylates tBid and promotes its proteasomal degradation. We then demonstrated that Itch has an antiapoptotic effect in...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... PAI-2) SJS174 GCTCACTGCCTA AGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2) SJS175 CTTTATTAGCTACA AAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2) SJS259 CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 1552–1585 ... CCTCTTACACTTGCTTTTGAC Forward (nt 455–474 pTETBBB) SJS170 GCAAAGGTGCCTTTGAGGTTG Reverse (nt 897–878 pTETBBB) ALS030 GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH) SJS209 CTTGATT...
Ngày tải lên: 16/02/2014, 09:20