Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion Tomoaki Hishida, Tsuyoshi Eguchi, Shigehiro Osada, ... 6E). These results imply that fad49 is crucial in the immediate early stage of adipocyte differentiation. As fad49 appears to play an impo...

Ngày tải lên: 16/03/2014, 04:20

... to the puri- fied protein (assuming no major change in the extinc- tion coefficient of the bound cofactor in the case of the mutants) [15]. The peak absorbance ratios showed first of all that the ... prevents catalysis. Indeed this residue has recently been studied in rat MCAD, where the arginine was mutated to alanine, lysine, glutamine and glutamic acid. The autho...

Ngày tải lên: 20/02/2014, 02:21

... PCR, using primers 5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a- 32 P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA). Hybridization ... PO & Matthews RG (2002) Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis. Proc Natl Acad Sci USA 99, 13471–13476. 30 Glatz A, Horva ´ th I, Var...

Ngày tải lên: 16/03/2014, 04:20

... coenzyme analog lacking the ade- nine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass through it. Intact cofa...

Ngày tải lên: 15/02/2014, 01:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of the ... in 14 additional amino acids from the vector at the N terminus of the expressed protein, includ- ing a hexahistidine tag that facilitated protein purification. The re...

Ngày tải lên: 18/02/2014, 14:20

... acetaldehyde and acrolein induce the expression of metallothionein and modulate protein tyrosine phosphatase activity in a zinc-dependent way. Since minute changes in the availability of cellular zinc have ... increase the cellular concentrations of aldehydes. A novel aspect of the molecular actions of aldehydes, e.g. acetaldehyde and acrolein, is their reaction wi...

Ngày tải lên: 19/02/2014, 06:20

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... receptor– ligand interactions [21]. If a smaller set of amino acids is structurally and functionally viable, then complete sampling becomes feasible for libraries in which a...

Ngày tải lên: 19/02/2014, 12:20

... define the value of a subgraph that contains p reactions and p concentrations, as minus the sum of all its combined autoinfluence paths of order p. Note therefore that negativity of a subgraph and positivity ... in the vicinity of the steady state. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in th...

Ngày tải lên: 19/02/2014, 16:20

... as substrate in PCR with the following Ras-GRF1 gene-speci- fic primers: ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT-3¢; ... can induce the activation of intracellular cascades such as the mitogen-activated protein (MAP) kinase – also called extracellular signal-regulated kinase (ERK) – cascade. The serine ⁄...

Ngày tải lên: 19/02/2014, 18:20

... technique of Pan et al. (2010). Both the LSA and FALSA techniques are based on latent semantic analysis (Pan et al., 2010). For the Within-Domain baseline, we train a binary classifier using the la- beled ... simply train a binary clas- sifier using unigrams and bigrams as features from the labeled reviews in the source domains and ap- ply the trained classifier on the targ...

Ngày tải lên: 20/02/2014, 04:20