0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion Tomoaki Hishida, Tsuyoshi Eguchi, Shigehiro Osada, ... 6E). These results imply thatfad49 is crucial in the immediate early stage of adipocyte differentiation. As fad49 appears to play an important role in the early stages of adipocyte differentiation, ... c(PPARc) and CCAAT ⁄ enhancer-binding protein a (C ⁄ EBPa) play important roles as master regulators[12]. In terminal differentiation, PPARc and C⁄ EBPatransactivate each other and upregulate the...
  • 13
  • 385
  • 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... to the puri-fied protein (assuming no major change in the extinc-tion coefficient of the bound cofactor in the case of the mutants) [15]. The peak absorbance ratios showedfirst of all that the ... preventscatalysis. Indeed this residue has recently been studied in rat MCAD, where the arginine was mutated toalanine, lysine, glutamine and glutamic acid. The authors found that the lysine mutant ... Two novel variants of human medium chain acyl-CoAdehydrogenase (MCAD)K364R, a folding mutation, and R256T, a catalytic-site mutationresulting in a well-folded but totally inactive proteinLinda...
  • 9
  • 533
  • 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... PCR, using primers5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAACCGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway,NJ, USA). Hybridization ... PO &Matthews RG (2002) Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis.Proc Natl Acad Sci USA 99, 13471–13476.30 Glatz A, Horva´th I, Varvasovszki ... helpfuldiscussion and Mr N. J. Halewood for his kind help in the correction of the English. They are also indebtedto Mr Masato Sasahara, Ms Yuka Katsuki andActivation of expression of fbaA in Synechocystis...
  • 12
  • 395
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl)(an inactive coenzyme analog containing the adeninering ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damagedcofactor to pass through it. Intact cofactor, an ade-nine-containing ... number of reactivationsper molecule of the reactivating factor was observed tobe approximately two, at a molar ratio of the reacti-vating factor to the enzyme of 0.5. As the reactivatingfactor...
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI siteand an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of the ... in 14 additional amino acids from the vector at the N terminus of the expressed protein, includ-ing a hexahistidine tag that facilitated protein purification. The recombinant plasmid was transformed ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

... acetaldehyde and acrolein induce the expression of metallothioneinand modulate protein tyrosine phosphatase activity in a zinc-dependentway. Since minute changes in the availability of cellular zinc have ... increase the cellular concentrations of aldehydes. A novel aspect of the molecular actions of aldehydes, e.g. acetaldehyde andacrolein, is their reaction with the cysteine ligands of zinc sites in ... predominant mechanism of zinc release is the modification of the cysteine lig-ands of zinc.Aldehydes increase the concentration of available cellular zincCultured human hepatocellular carcinoma (HepG2)cells...
  • 11
  • 473
  • 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... this strainand the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosinereports on the chorismate mutase activity ... receptor–ligand interactions [21].If a smaller set of amino acids is structurally andfunctionally viable, then complete sampling becomesfeasible for libraries in which a larger number of aminoacids are ... process on an individual catalytic activity. A great advantage of genetic selection systems is the abilityto perform parallel processing of huge libraries (rather than the serial analysis required...
  • 8
  • 635
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... define the value of a subgraph that contains p reactions and p concentrations, asminus the sum of all its combined autoinfluence paths of order p. Note therefore that negativity of a subgraph andpositivity ... in the vicinity of the steadystate. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in the concentration of substance j, i.e. Dxj,hasonthetimedisplacement ... (negative) in uence a substrate has on its own removal. It is obtained for allsubstrates of any elementary reaction. The main point of the present section is that any Jacobianmatrix element equals the...
  • 11
  • 638
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... assubstrate in PCR with the following Ras-GRF1 gene-speci-fic primers: ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ... can induce the activation of intracellular cascades such as the mitogen-activated protein (MAP) kinase – also calledextracellular signal-regulated kinase (ERK) – cascade. The serine ⁄ threonine ... physiological role of the guanine nucleotide exchange activity of the truncatedforms is not known as they are missing the Ca2+⁄CaM-binding IQ domain that is involved in the activa-tion of Ras-GRF1.Stimulation...
  • 13
  • 730
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc

... technique of Pan et al. (2010). Both the LSAand FALSA techniques are based on latent semanticanalysis (Pan et al., 2010). For the Within-Domainbaseline, we train a binary classifier using the la-beled ... simply train a binary clas-sifier using unigrams and bigrams as features from the labeled reviews in the source domains and ap-ply the trained classifier on the target domain. Thiscan be considered ... mutual information between a feature (uni-gram or bigram) and a domain label. After selectingsalient features, the SCL algorithm is used to train a binary classifier. SFA is the spectral feature align-ment...
  • 10
  • 555
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP