Báo cáo khoa học: Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview docx
... Columbia, Vancouver, Canada Gonadotropin theory of ovarian cancer Ovarian cancer is the most lethal gynecological malig- nancy. Although epithelial ovarian carcinomas account for approximately ... 5509 kinase-signaling pathways. Mol Endocrinol 12, 451– 457. 87 Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, Tahara M, Hisamoto K, Kurachi H & Murata Y (2000) Activation o...
Ngày tải lên: 16/03/2014, 04:20
... Natl Acad Sci USA 99, 11778–11783. 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al. (2002) DMY is a Y-spe- cific DM-domain ... Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically female (XX) medaka fish. Proc Natl Acad Sci USA...
Ngày tải lên: 14/02/2014, 19:20
... si-NF-jB1, an 70 bp double-stranded si-NF-jB1 was obtained by annealing using two single-strands NF- jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG GAAA-3¢; and NF-jB1-Bot, ... NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA TGAAACATTTGTTCAGGCGG-3¢, and then cloned into pSilencer 2.1 neo vector (Ambion). Annealing was per- formed as: 95 °...
Ngày tải lên: 07/03/2014, 00:20
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... by a process called inducer exclusion, whereas phosphorylated EIIA activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical ... system was analysed for a large number of substrates using a mathematical model, and it was shown that, in the case of non-PTS carbohydrates (carbohydrates that are not phosphorylated durin...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx
... describes a general approach to the design of natural language interfaces that has evolved during the development of DATALOG, an Eng- lish database query system based on Cascaded ATN grammar. By ... development of DATALOG (for "database dialogue") an esperimental system that accepts a wide variety of English queries and commands and retreives the answer from the user...
Ngày tải lên: 17/03/2014, 19:21
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... Yokohama City University, Fukuura, Kanazawa, Yokohama; 3 Pharmaceutical Research Department 4, Kamakura Research Laboratories, Chugai Pharmaceutical Co. Ltd, Kajiwara, Kamakura, Kanagawa, Japan Thyroid ... 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ for 4-1BB, 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and 5¢-CCCGGGATATCTAAGTGCTGG TCTCCACAA...
Ngày tải lên: 23/03/2014, 18:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nucleotide-free forms. ... the a, b and c subunits of the enzyme are abbreviated as a D , b D , and c D , respectively, and the a and b subunits of the reactivase are abbrevi- ated as a R...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc
... phPGK1–5aa–cerulean were constructed using the primers 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A- 3¢, and 5¢- CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and ... and 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCG G-3¢, and 5¢-CGGAA TTCCG ATGGG GAAGG TGA AG GTCGG-3¢ and 5¢-CGACC GGTGT CTCCT TGG AG GCCAT GTGGG-3¢, respectively, and pcitrine-N1....
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf
... limits DNA damage and maintains self-renewal of leukaemia stem cells. Nature 457, 51–56. 49 Seoane J, Le HV, Shen L, Anderson SA & Massague ´ J (2004) Integration of Smad and forkhead pathways ... reactions such as b-catenin and insulin signaling, as well as apoptosis. Active GSK3 blocks HH signaling via SMO, and also blocks apoptosis and MYC-mediated actions. Moreover, it allow...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... Moreover, thermal denaturation analysis of NarJ and NarJT carried out by DSC entailed a nontwo-state transition followed by irreversible processes. The temperature dependence of the partial molar heat capacity ... microcalorimeter (Microcal LLC, Northampton, MA, USA) at 298 K. The experimental data fitting was carried out using origin 7.0 (Origin Lab Corporation, Northampton, MA, USA). Nar...
Ngày tải lên: 16/02/2014, 14:20