Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E)PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid ... Change GCC–GGC in A5 5 (kid A5 5G)PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA ... D75N)PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change ATC–TTA in D75 (kid D75N)PR73H()) ACCACAGGTGTTGTACATTGCGATCAACC Change CGT–CAT in R73 (kid R73H)PR73H(+) GGTTGATCGCAATGTACAACACCTGTGGT Change ACG–ATG...

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... a method of re-estimating the population probabilities of the types in the sample as well as estimating the probability mass of unseen types. There is also work on the estimation of the theoretical ... kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the ... the other hand, Pf and Rf express the quantitative status of the morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of...

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... A comparative analysis of the time-dependent antiproliferativeeffects of daunorubicin and WP631Silvia Villamarı´n1,*, Sylvia Mansilla1,*, Neus Ferrer-Miralles1, Waldemar Priebe2and ... drugaccumulated in the cells. Despite the slow uptake rate, the antiproliferative capacity of WP631 (measured as IC50after a 72-h continuous treatment) was greater than that of daunorubicin. The propensities ... preparation was examined. A cellgallery was created by relocation of cells from each of the major peaks in the histogram of integrated red ﬂuorescence. The presence of polyploid cells was determined...

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... specifying an antenna performing a specific function. (a transmit antenna). (1) Request antenna shipped by fastest available means. (2) Transmit antenna shipped by fastest available means. The ... PHRASES We can recognize the sources of text compression by two means: (1) comparing a full grammar of the standard language to that of the domain in which we are working, 505 and {2) comparing ... modifier-host semantic patterns through a distributional analysis of the texts. The basis for sub- language work is that the semantic patterns are a res- tricted, limited set. They talk about a limited...

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... and then treatedwith deoxyribonuclease (DNase I, ampliﬁcation grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis ... on the acegene microarray database (DNA Chip ResearchInc. and Hitachi Software Co., Yokohama, Japan). The sig-niﬁcance of GO term appearance in the up- and down-regulated genes (compared with all ... immuno-chemical staining to examine the cell population of AT-MSC-Hepa for microarray analysis. This analysis showed that the AT-MSC-Hepa cell population wasalmost totally homogeneous ([16], and data not...

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

... employ machine learn-ing techniques to automatically catego-rize the gender of each speaker given only the transcript of his/her speech, achiev-ing 92% accuracy. An analysis of the most characteristic ... can help improve the performance of a number of natural language processing tasks,such as text classiﬁcation, machine translation orautomatic speech recognition by training better lan-guage ... Proceedings of the 43rd Annual Meeting of the ACL, pages 435–442,Ann Arbor, June 2005.c2005 Association for Computational Linguistics A Quantitative Analysis of Lexical Differences Between...

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... probabilityover a range of possible parameters, and per-mits the use of priors favoring the sparsedistributions that are typical of natural lan-guage. Our model has the structure of a standard ... for the hidden vari-ables in the model are then chosen based on the learned parameterization. Here, we propose a dif-ferent approach based on Bayesian statistical prin-ciples: rather than searching ... weachieve average tagging accuracy of 86.8%. Thisfar surpasses the MLHMM performance of 74.5%,and is closer to the 90.1% accuracy of CRF/CE on the same data set using oracle parameter selection.The...

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... as well as model the adjacent output labels. The additional features we167introduced are:• the distance to the next same word and the nextsame POS tag.• a binary feature to indicate if there ... features:• All the bigrams and trigrams of words and POStags in the candidate sentence.• Bigrams and trigrams of words and POS tags in the original sentence in combination with theirbinary labels ... of the candidate sentence with that of the ﬁrst ranked candidate. This is because we tryto avoid a very large or small compression ra-tio, and the ﬁrst candidate is generally a goodcandidate...

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

... clearance and further metabo-lism of the allergen was altered as a result of the inﬂammation in the lungs of sensitized animals.Up to now there are few data available on the fate of an allergen after ... instillation of [75Se]Der p 2 instead of the last aerosol challenge atday 30. Analysis of BAL ﬂuid from mice instilled withnonlabelled Der p 2 at day 30 displayed an airwayinﬂammation 18 h after ... strongest radio-activity labelling. The radioactivity decreased with timeand at 48 h the radioactivity detected in lung wasapproximately of the same intensity as that of the kidney cortex. Separate...

Báo cáo khoa học: "A Morphological Analysis Based Method for Spelling Correction" docx

...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP