... CONCEPTUAL RELATION is a subset of CONCEPTUAL SYMBOL: AGT relation , OBJ relation . POSSess relation, LOC relation and the other 41 relations. Relations are directed binary relations including ... head, the true semantic head of w3 can be found among the words (wl and w2) syntactically dependent on the word, w3. That is the word, wl. Furthermore, the crossing of...
Ngày tải lên: 09/03/2014, 01:20
... investigated whether HSS could function as an MPT inhibitor, thereby alle- viating hepatic injury and promoting the survival of hepatocytes, after transfection of HSS into the cells or the administration ... to the uncoupling of oxidative phosphorylation. MPT is caused by the opening of the nonselective, highly conductive PTP in the mitochon- drial IM [39]. The exact m...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt
... requires a complete MATH domain and the N-terminal region of RAP2.4 The use of a truncated version of BPM1 in the Y2H screens demonstrated that the BTB domain is not involved in the assembly with ... and in the anthers of dif- ferentiated flowers. We also detected meagre expres- sion along the root, with most obvious staining present at the lateral root primordia and...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx
... 1. The differences in K m and k cat are not significant, suggesting that the catalytic activity of PHR does not depend on the presence of the regulatory protein. Fig. 2. MALDI-TOF spectrum of ... subtracted from the consumption recorded after addition of 1 m M phenol. The effects of PHI and PHR concentrations on the overall PH activity were evaluated by systematic varia...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... decrease of absorption in the 1300–900 cm )1 region, characteristic of the protein/nucleic acid ratio. The DNA/RNA ratio, calculated as the r atio of the intensity at 1020 cm )1 (representative of ... greatest part of the original data information. In the second part of our work, we focused on the biochemical information available i n infrared s pectra, and we fo...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc
... concerning the size of the ion. Thus, the affinity of the different metal ions in MTs is governed primarily by the thermody- namic stability of the thiolate–metal bond. Therefore, soft metals ... com- plete loss of the Cd 3 -CysS 9 resonances. The reported data indicate that the b-domain provides the binding site for the eighth equivalent of Zn(II) [and Cd(II)]....
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... site [35]. To test the alternative hypothesis that one of the other components of the MLL1 core complex catalyzes dimethylation of H3K4, we assembled the MLL1 core complex with a catalytically inactive ... number of conserved functional domains that work together for the assembly of multiprotein complexes that influence the appropriate targeting and regulation of the...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... 208 backbone cleavages (Fig. 6); the ECD cleavages not only indicate the five phosphorylation sites without loss of these side chains, but also that these cleavages are so positioned that they would ... characterization of the protein. Its quantitative analysis by the bottom-up method under normal and abnormal conditions can then provide a direct indica- tion of the upregulatio...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt
... Hu-K4. We describe the correction of the originally proposed ORF, the identification of splice variants, and the determination of the expression pattern using mRNA hybridization and a new specific ... was stained by the antiserum only in the absence of the peptides used for immunization. Other proteins were also stained by the saturated anti- serum (Fig. 5B). The seq...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... minute. The relative values of simultaneous modulation of the three las enzymes are calculated as the average of the three individual relative activities. Construction of...
Ngày tải lên: 19/02/2014, 17:20