Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... the
formation of these covalent bonds. The amino acids
that are involved in specific interactions with the flavin
ring system and may facilitate formation of the cova-
lent protein–flavin bond are ... (again, FAD is linked via an
8-carbon rather than 8a- carbon linkage) resulted in an
increased k
cat
value with d-alanine from 1.5 s
)1
for the
mutant enzyme, containing n...
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx
... natural language system
is that it often has only partial information about the
individuals (objects, events, and relations) that are talked
about. Unless one assumes that the original linguistic ...
generalize our representation by introducing the
predicate
ROLE
and making rolenames into individuals
in the domain.
ROLE( o, r, v)
asserts that individual o has
a role...
Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot
... annotation and dis-
cusses their problem.
Some research addresses the detection of er-
rors in pos-annotation (Nakagawa and Matsumoto,
2002; Dickinson and Meurers, 200 3a) , syntactic
annotation ... Substitution Grammar
Yoshihide Kato
1
and Shigeki Matsubara
2
1
Information Technology Center, Nagoya University
2
Graduate School of Information Science, Nagoya University
Furo-ch...
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
... small ran-
dom selection of data consisting of 10 dialogues
from each of the Shared Visual Information and
No Shared Visual Information conditions. Each
of these dialogues was collected from a ... 1998), chang-
ing the amount of available visual information
impacts information gathering and recovery from
ambiguous help requests (Karsenty, 1999), and
varying the fi...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...
Tài liệu Báo cáo khoa học: "Event Extraction in a Plot Advice Agent" doc
... both natural language understanding and
advice generation in the domain of narrative in-
struction. The background application is a fully
automated plot analysis agent to improve the writ-
ing of ... A and B there was a Cronbach’s α statistic
of .90 and a Kendall’s τ
b
statistic of .74. Between
Rater B and C there was a Cronbach’s α statis-
tic of .87 an...
Tài liệu Báo cáo khoa học: "Contrastive accent in a data-to-speech system" doc
... (1 )a and b.
Since A and B are of the same type, the values of
their fields can be compared, showing which pieces
of information are contrastive. Figure 1 shows that
all the fields of B have ... instance, the contrast in
(1) is based on the knowledge that kicking the ball
into the wrong goal implies scoring a goal for the
opposing team. In a HOU...
Tài liệu Báo cáo khoa học: "Ambiguity resolution in a reductionistic parser" pot
... clause-internal relations, has to ascer-
tain that the words and features referred to are in
the same clause - again in a roundabout and usually
partial fashion.
Indeed, it is argued in [Voutilainen, ... SparcStationl0, using a disambiguation
grammar of some 1300 constraints.
Intensive work within the finite-state framework
was started by Tapanainen [1991] in 199...
Tài liệu Báo cáo khoa học: "VP Ellipsis in a DRT-implementation" pot
... emphasis of the implementation lies on anaphora
resolution (like do-anaphora and pronouns) in a do-
main of a small fragment of English. A parse of a
typical discourse is:
> Mary likes a cat. ... the NP
a cat
has narrow scope within the
quantified phrase every woman, and therefore not
accessible in the main DRS (as in standard DRT).
In a s...
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx
... relied on. As
a consequence of nationalization, one text may be
substantially longer than the other and this makes
the length correspondence assumption incorrect (if
the additions and omission ...
to handle insertions and deletions. The algorithm
that was developed for aligning paragraphs is a nat-
ural choice. It handles insertions and deletions suc-
cessfully an...
Từ khóa: