Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... the formation of these covalent bonds. The amino acids that are involved in specific interactions with the flavin ring system and may facilitate formation of the cova- lent protein–flavin bond are ... (again, FAD is linked via an 8-carbon rather than 8a- carbon linkage) resulted in an increased k cat value with d-alanine from 1.5 s )1 for the mutant enzyme, containing n...

Ngày tải lên: 16/03/2014, 01:20

23 565 0
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

... natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. Unless one assumes that the original linguistic ... generalize our representation by introducing the predicate ROLE and making rolenames into individuals in the domain. ROLE( o, r, v) asserts that individual o has a role...

Ngày tải lên: 21/02/2014, 20:20

9 483 0
Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

... annotation and dis- cusses their problem. Some research addresses the detection of er- rors in pos-annotation (Nakagawa and Matsumoto, 2002; Dickinson and Meurers, 200 3a) , syntactic annotation ... Substitution Grammar Yoshihide Kato 1 and Shigeki Matsubara 2 1 Information Technology Center, Nagoya University 2 Graduate School of Information Science, Nagoya University Furo-ch...

Ngày tải lên: 30/03/2014, 21:20

6 367 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

... small ran- dom selection of data consisting of 10 dialogues from each of the Shared Visual Information and No Shared Visual Information conditions. Each of these dialogues was collected from a ... 1998), chang- ing the amount of available visual information impacts information gathering and recovery from ambiguous help requests (Karsenty, 1999), and varying the fi...

Ngày tải lên: 24/03/2014, 03:20

8 567 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Event Extraction in a Plot Advice Agent" doc

Tài liệu Báo cáo khoa học: "Event Extraction in a Plot Advice Agent" doc

... both natural language understanding and advice generation in the domain of narrative in- struction. The background application is a fully automated plot analysis agent to improve the writ- ing of ... A and B there was a Cronbach’s α statistic of .90 and a Kendall’s τ b statistic of .74. Between Rater B and C there was a Cronbach’s α statis- tic of .87 an...

Ngày tải lên: 20/02/2014, 12:20

8 420 0
Tài liệu Báo cáo khoa học: "Contrastive accent in a data-to-speech system" doc

Tài liệu Báo cáo khoa học: "Contrastive accent in a data-to-speech system" doc

... (1 )a and b. Since A and B are of the same type, the values of their fields can be compared, showing which pieces of information are contrastive. Figure 1 shows that all the fields of B have ... instance, the contrast in (1) is based on the knowledge that kicking the ball into the wrong goal implies scoring a goal for the opposing team. In a HOU...

Ngày tải lên: 22/02/2014, 03:20

3 394 0
Tài liệu Báo cáo khoa học: "Ambiguity resolution in a reductionistic parser" pot

Tài liệu Báo cáo khoa học: "Ambiguity resolution in a reductionistic parser" pot

... clause-internal relations, has to ascer- tain that the words and features referred to are in the same clause - again in a roundabout and usually partial fashion. Indeed, it is argued in [Voutilainen, ... SparcStationl0, using a disambiguation grammar of some 1300 constraints. Intensive work within the finite-state framework was started by Tapanainen [1991] in 199...

Ngày tải lên: 22/02/2014, 10:20

10 373 0
Tài liệu Báo cáo khoa học: "VP Ellipsis in a DRT-implementation" pot

Tài liệu Báo cáo khoa học: "VP Ellipsis in a DRT-implementation" pot

... emphasis of the implementation lies on anaphora resolution (like do-anaphora and pronouns) in a do- main of a small fragment of English. A parse of a typical discourse is: > Mary likes a cat. ... the NP a cat has narrow scope within the quantified phrase every woman, and therefore not accessible in the main DRS (as in standard DRT). In a s...

Ngày tải lên: 22/02/2014, 10:20

6 312 0
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

... relied on. As a consequence of nationalization, one text may be substantially longer than the other and this makes the length correspondence assumption incorrect (if the additions and omission ... to handle insertions and deletions. The algorithm that was developed for aligning paragraphs is a nat- ural choice. It handles insertions and deletions suc- cessfully an...

Ngày tải lên: 22/02/2014, 10:20

5 456 0
Từ khóa:
w