Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... The Authors Journal compilation ª 2009 FEBS MINIREVIEW Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics Annette S. Gillings, Kathryn ... FEBS providing a rationale for the use of combinations of MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors. Indeed, rapamycin, an inhibitor of mammalian...

Ngày tải lên: 16/03/2014, 00:20

13 453 0
Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt

Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt

... Regulation of DNA damage-induced cell death by p53 and HIPK2. Genotoxic stress-induced DNA damage facilitates activation of the DNA damage-activated protein kinases ATM and ATR. ATR and ATM in turn ... molecular markers indicative for an active DDR, including site-specifically Keywords apoptosis; ataxia-telangiectasia mutated (ATM); ataxia-telangiectasia mutated and Rad3-rel...

Ngày tải lên: 16/03/2014, 00:20

10 466 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... dehydrogenase protein com- plexes were replaced by genes encoding monofunctional versions of the dehydratase and the dehydrogenase. The growth of this strain on minimal med...

Ngày tải lên: 19/02/2014, 12:20

8 635 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

... the interface between a solid and a liquid phase, and cal- culated as the ratio of two rate constants. However, values of DDG and DDG¢ for mutant Fab fragments, calculated from values of K D and ... which MalE-E3-H6 was immobilized in the wells of a microtiter plate and the bound Fab4E11-H6 was revealed with a goat antibody, directed against mouse Fab and conju...

Ngày tải lên: 19/02/2014, 07:20

13 659 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... Moun- tains of California. Details of animal holding, feeding and hibernation were described in [15]. All possible measures were taken to minimise pain and discomfort during animal euthanasia in accordance ... phosphofructokinase at 5 °C. Activities are expressed relative to the PFK activity in the absence of phosphate at each pH value. PFK activity was measured as descr...

Ngày tải lên: 19/02/2014, 16:20

9 579 0
Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

... streptokinase to a fibrin-targeted plasminogen activator. Proc.NatlAcad.Sci.USA96, 8879–8883. 12. Lin, L.F., Houng, A. & Reed, G.L. (2000) Epsilon amino caproic acid inhibits streptokinase–plasminogen ... mgÆmL )1 . Data were recorded using a scan rate of 50 nmÆmin )1 and a response time of 1 s. Cuvette path lengths were 0.1 cm. An average of 10 scans was obtained. A b...

Ngày tải lên: 21/02/2014, 03:20

13 504 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... C1 and C2 domains appeared to be joined by a ‘linker’ sequence. Also boxed are the transmembrane domain and the serine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea ... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel- opment (blastula, gastrula, trochophore larvae,...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

... an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent ways: as an unstr...

Ngày tải lên: 17/03/2014, 09:20

3 255 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... immunodiffusion, passive haemaggluti- nation and inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C. braakii PCM 1531 and PCM 1487. In double immunodiffusion ... built up of branched trisaccharide repeating units, in which D -ara4dHexisattachedasaside- chain to a GlcNAc residue in a disaccharide main chain (structure 2) [6,12...

Ngày tải lên: 23/03/2014, 17:22

7 478 0
w