Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... B=MIC B Þ=n where A and B are the MICs of drug A and drug B in the combination, MIC A and MIC B are the MICs of drug A and drug B alone, FIC A and FIC B are the FICs of drug A and drug B and n is the number of ... level of a limited number of proteins in Escherichia coli Ludovica Marcellini 1 , Marina Borro 1 , Giovanna Genti...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

... both a- and b-toxins for binding to rat brain synaptosomes and with excitatory anti-insect selective toxins in insect neuronal membranes. We show that Lqhb1 a ects insect and mammalian NaCh subtypes ... channels (NaCh) are polypeptides of 6 1–7 6 amino acids long that traditionally are divided between two major classes, a and b, according to their physiological effects...

Ngày tải lên: 31/03/2014, 01:20

8 391 0
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... cellular retinaldehyde-binding protein. After 2 h of incuba- tion at 37 °C in the dark, the generated retinoids were extracted with 300 lL of methanol and 300 lL of hexane and analyzed by normal-phase ... membrane Olga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing Ma Departments of Cell Biology and Medicine Endocrinology, Harold Hamm Oklahoma Diabetes Ce...

Ngày tải lên: 18/02/2014, 08:20

11 587 0
Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

... gastrointestinal hormone peptides tested contain a proline at P1, which may be a cause of the poor FAP cleavage of these peptides (all had a half-life of greater than 15 h). These new data on natural ... being cleaved off with a half-life of 60 min. Cleavage resulted in a predominant peak of 4047 Da. Intact NPY had an average observed molecular mass of 4265 Da. NPY...

Ngày tải lên: 14/03/2014, 23:20

17 425 0
Báo cáo khoa học: 2-Amino-nonyl-6-methoxyl-tetralin muriate activity against Candida albicans augments endogenous reactive oxygen species production – a microarray analysis study doc

Báo cáo khoa học: 2-Amino-nonyl-6-methoxyl-tetralin muriate activity against Candida albicans augments endogenous reactive oxygen species production – a microarray analysis study doc

... CCAACCCTAATCTGTCG 177 CBP3 F: TAATGCCAATGAGAATG R: TCAGGAGGCACAAACT 132 COR1 F: AACAACAACACCGTCAT R: TTGGCAAAGTATCGTCT 160 RIP1 F: CGGTCAAGGAAGCAGAA R: TTGGCAAAGTATCGTCT 110 CYT1 F: GCTATGGCTGAAGAAT R: CTGGGAAGTAAGGGTT 280 QCR8 ... GTGCCTTTATTGCTGAT R: AGATTCTGGGTCGTTTG 182 GPX1 F: TGAAAGGGAAAGTTGTC R: TCCAAGACTGGGAATGT 217 GPX2 F: ACTCCACAATACAAAGGTT R: AATACGGGGAAAGTCAC 164 SOD5 F: ACATTGGC...

Ngày tải lên: 28/03/2014, 23:20

11 336 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx

Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx

... mutant mesotrypsin was inhibited by wild-type a1 AT in a manner that was comparable with inhibition of cationic and anionic trypsins, demonstrating that Arg198 is the critical determinant of resistance ... against inhibitor concentration and the equival- ence point was determined from the y-intercept of the extrapolation of the linear portion of the titrat...

Ngày tải lên: 30/03/2014, 10:20

13 433 0
Tài liệu Báo cáo khoa học: Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity docx

Tài liệu Báo cáo khoa học: Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity docx

... [102]. Patients with rosacea have abnormal in ammation and vascular reactivity in facial skin. These individuals have high levels of cathelicidin and higher levels of the enzyme that processes the propeptide ... well as in epithelial cell migration, further suggesting a function for hBD2 in healing and protection of the intestinal epithelial barrier [70]. Proinfl...

Ngày tải lên: 18/02/2014, 06:20

12 639 0
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... points after the AG1478 addition and analyzed for caspase 3 activity by using a fluorometric substrate-based assay. Each point is the mean of triplicate samples, and the bar represents the standard ... indicated time points after the AG1478 addition and analyzed for caspase 3 activ- ity by using a fluorometric substrate-based assay. Each point is the mean of the trip...

Ngày tải lên: 18/02/2014, 13:20

11 659 0
Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... 5¢-TCTCTGCTGC CAGACA-3¢ and 5¢-GCCACAGCAGAACAGA-3¢ for HVEM; 5¢-TCCTTCACCGATGGCACTATCC-3¢ and 5¢-TCAACACCAGCAGGATGCTC-3¢ for nectin-1; and 5¢-AGAAGCAGCAGCACCAGCAG-3¢ and 5¢-GTCACG TTCAGCCAGGA-3¢ for nectin-2. ... that F-actin cytoskeletal changes may be related to enhanced and more productive viral infection, and the interaction of the virus with nectin-1 may play a cr...

Ngày tải lên: 18/02/2014, 14:20

14 672 0
Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

... GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing s ite f or the upstream primer corresponds to 12 amino acids before the protease sequence. These ... [9], amprenavir [10], lopinavir [11] and atazanavir [12]), there is an urgent need for improved drugs against HIV protease because of increasing viral resistance and...

Ngày tải lên: 19/02/2014, 16:20

9 560 0
w