Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc

Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc

Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc

... compilation ª 2010 FEBS 4673 The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids Daniel ... source of apocarotenoids. In mam- mals, the synthesis of apocarotenoids, including retinoic acid, is initiated by the b-carotene cleavage oxygenases I...

Ngày tải lên: 15/03/2014, 23:20

12 377 0
Tài liệu Báo cáo khoa học: The Mycobacterium tuberculosis membrane protein Rv2560 ) biochemical and functional studies pdf

Tài liệu Báo cáo khoa học: The Mycobacterium tuberculosis membrane protein Rv2560 ) biochemical and functional studies pdf

... blotting was performed with rabbit preimmune and post-third inoculation sera against a M. tuberculosis sonicate (lanes 1, 2 and 5) and a membrane frac- tion (lanes 3 and 4). Lanes 1 and 3, absence of ... by measuring the cell-associated radioactivity on a gamma counter. Triplicate assay data were averaged. The curves obtained were analysed and the dissociation con-...

Ngày tải lên: 18/02/2014, 16:20

13 492 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... anti-flag WB anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP M HA-DDX21 Fig. ... anti-TIAR TIAR-TAP TIAR-CBP TIAR TA P TA P TIAR-TAP 6 6A 7 6 7 –++ RT-PCR WB anti-TIAR TIAR-TAP TIAR C B Fig. 1. Functional characterization of TIAR-TAP protein and purification...

Ngày tải lên: 16/02/2014, 15:20

19 666 0
Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

... used at a final concentration of 8 lm. The reaction was started by the addition of SAM to a final concentration of 200 lm and was incubated at 37 °C in the dark. The reaction was monitored using a ... siroheme and cofactor F 430 and is not a real heme [5]. The unique structural features of heme d 1 are the oxo groups on C-3 and C-8, the acrylate substituent...

Ngày tải lên: 18/02/2014, 06:20

10 539 0
Tài liệu Báo cáo khoa học: The double-stranded RNA-binding motif, a versatile macromolecular docking platform doc

Tài liệu Báo cáo khoa học: The double-stranded RNA-binding motif, a versatile macromolecular docking platform doc

... func- tionally separated interaction modes. These are the interaction of residues of the protein loops 2 and 4 with 2¢OH and phosphate groups of sequential minor and major grooves of the RNA helix, and ... class of macromolecules (DNA, RNA and protein) makes it a good candidate for a regulator of nucleic acids meta- bolism. The effect of distinct ligand bin...

Ngày tải lên: 19/02/2014, 17:20

9 543 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4–TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG Vps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table ... oligo- merization domain (i.e. b sheets 7 and 8, the AAA domain helix and the C-terminal helix). However, the majority of these proteins are...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the targ...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo khoa học: The Thermoplasma acidophilum Lon protease has a Ser-Lys dyad active site pot

Báo cáo khoa học: The Thermoplasma acidophilum Lon protease has a Ser-Lys dyad active site pot

... as mentioned above, which impairs alignment of the bacterial with t he archaeal ATPase domain. After removing the 90-residue insert the bacterial and archaeal Walker A and W alker B motifs can ... [21] (Fig. 1 A, B). TaLon encompasses an N-terminal ATPase associated with various cellular a ctivities ( AAA + domain) and a C-terminal protease domain, but lacks the N-termi...

Ngày tải lên: 30/03/2014, 15:20

5 298 0
Báo cáo khoa học: The sigma factors of Mycobacterium tuberculosis: regulation of the regulators potx

Báo cáo khoa học: The sigma factors of Mycobacterium tuberculosis: regulation of the regulators potx

... factor(s) to the core RNAP to carry out the coordinate expression of a specific subset of genes. The availability of the alternative r factors is controlled at the transcriptional, translational and post-translational ... in M. tuberculosis to date, of which three, namely regulator of sigmaE A (RseA), regulator of sigmaH A (RshA) and regulator of sigmaL A...

Ngày tải lên: 15/03/2014, 09:20

22 348 0
Báo cáo khoa học: The effect of HAMP domains on class IIIb adenylyl cyclases from Mycobacterium tuberculosis pptx

Báo cáo khoa học: The effect of HAMP domains on class IIIb adenylyl cyclases from Mycobacterium tuberculosis pptx

... cyclases in this pathogen. The proteins consist of a membrane anchor, a HAMP region and a class IIIb adenylyl cyclase catalytic domain. Expression and purification of the isolated catalytic domains ... partners of the mycobacterial CHDs include membrane anchors, a novel autoinhibitory domain, AAA- ATPase domains, helix-turn-helix DNA-binding domains, an a/ b-hydrolase...

Ngày tải lên: 23/03/2014, 12:20

6 443 0
Từ khóa:
w