Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann Ruhr-Universita ¨ t Bochum, Physikalische ... molecular mechanism. Nature 349, 117–127. 3 Herrmann C, Martin GA and Wittinghofer A (19 95) Quantitative analysis of the complex between p21ras and th...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khóa học: Structural properties of the protein SV-IV potx
... Structural properties of the protein SV-IV Carlo Caporale 1 , Carla Caruso 1 , Giovanni Colonna 2,3 , Angelo Facchiano 4 , Pasquale Ferranti 4 ,5 , Gianfranco Mamone 4 , Gianluca Picariello 4 , Flavia ... cases, a mixture of the native and acetylated peptides was observed and identified by the mass increase of 42 mass units. The relative level of acetylation of a...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt
... siRNA ZF5 (5 -GAGGAAGCAUGA GAAACUCUU-3¢ and 5 -GAGUUUCUCAUGCUUCCU CUU-3¢) matched bases 9 45 963; and the third siRNA ZF5 (5 -GGUCCUGAACUACAUGUACUU-3¢ and 5 -GUAC AUGUAGUUCAGGACCUU-3¢) matched bases ... Primer software developed by V. Prutkovsky and O. Sokur of the Institute of Influenza, Ministry of Health of the Russian Federation. The first pair of primers (5 -...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Adhesion properties of adhesion-regulating molecule 1 protein on endothelial cells pptx
... endothelial venules promotes the adhe- sion and chemotaxis of naive T lymphocytes. Proc Natl Acad Sci USA 95, 258 –263. 10 Stein JV, Rot A, Luo Y, Narasimhaswamy M, Nakano H, Gunn MD, Matsuzawa A, ... Molecular cloning and characterization of the complementary DNA of an M (r) 110,000 antigen expressed by human gastric carcinoma cells and upregu- lated by gamma-interferon....
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot
... Guimaraes da Costa F, Paschoal ME, Ronco LV, Carvalho MG & Pardee AB (1999) Identifi- cation of a gene encoding a human oxysterol -binding protein- homolog: a potential general molecular marker for ... 20 05 FEBS 47 15 Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae Penghua Wang 1 , Wei Duan 1 , Alan L. M...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf
... K, Iizuka M, Watanabe T, Nakagawa J, Kawasaki S & Niimura Y (2007) Synechocystis DrgA protein functioning as nitroreductase and ferric reductase is capable of catalyzing the Fenton reaction. FEBS ... 5 -ACGTGAAGGTGGACGAATCC-3¢ (20-mer). We identi- fied the flavoredoxin gene in the complementary strand upstream of the ABC transporter, and then designed a 30-mer probe DNA...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot
... CCAACTTATGTCCCGACT CTGCATCTGTGAAAGT CaDHODH-rev, CCGGAATTCCTTATCATCAGAG CCAATTAT Ca-BamHI-for, GCGGATCCCGAATGTTTCGTCC AAGTATCAAATTCAAACAGTCG Cak-BamHI-for, GCGGATCCCGAATGTCAAGAT CAGCAATCCATGAATATGTTTTGTGC CaDHODH-rev3, CCGGAATTCTCACTTATCATC AGAGCCAATTATTTGCTCCCATG Expression ... ATGTTTCGTCCAAGTATCAAAT TC ZGCaURA1–3¢, TCACTTATCATCAGAGCC Ca-forlong2, ATGTTTCGTCCAAGTATCAAATTC AAACAGTCGACTTTGTCC...
Ngày tải lên: 07/03/2014, 12:20
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... Suzuki 5 and Yasushi Kawata 3,4 1 National Institute of Advanced Industrial Science and Technology, Ikeda, Osaka, Japan 2 Department of Food Science and Nutrition, Faculty of Human Life and Science, ... and catalysis. Biochemistry 48, 3417–3424. 31 Nakamura T, Matsumura H, Inoue T, Kai Y, Uegaki K, Hagihara Y, Ataka M & Ishikawa K (20 05) Crystallization and prelimi...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... cannot, however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa- tion properties of the signal at 77 K indicate that the Y Æ is coupled to a paramagnetic ... Bruker software, as described above. Analysis of metals Manganese and iron have been determined by GF-AAS and ICP-MS. [As a result of problems with the pro...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Solution properties of full-length integrin aIIbb3 refined models suggest environment-dependent induction of alternative bent ⁄extended resting states doc
... I) and A2 bB3-eots (panels E and J), are shown as ribbons (protein only, panels A E) and as surface (protein) and space-filling (carbohydrates and OG moieties) representations (panels F–J). The a IIb b 3 modules ... tail separation was in accordance with both the ET and hydrodynamic data of primed a IIb b 3 . Our revised mod- els further support an alternative view o...
Ngày tải lên: 18/02/2014, 04:20