Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... kinetic parameters K m , V max and k cat were determined for the purified AATB3. Values for K m and V max for both amino donors (l -aspartate and l-glutamate) and ac- ceptors (a- ketoglutarate and oxaloacetate) ... L-glutamate. The activity of L -aspartate was adjusted to 100. b 30 mML -aspartate was used as amino donor for a- ketoglutarate, and 30 m ML-gluta- mate was used a...

Ngày tải lên: 14/03/2014, 23:20

13 490 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

... equation. All reducing sugar assays included a glucose standard curve. The average molecular mass of the XG oligosaccha- rides (XGOs) was calculated from the manufacturer’s data and was found ... Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca Diana C. Irwin, Mark Cheng*, Bosong Xiang†, Jocelyn K. C. Rose‡ and David B. Wilso...

Ngày tải lên: 23/03/2014, 21:20

9 453 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

... sulfate fraction; lane 4, recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers ... b-lactoglobulin A, pI 5.1; myoglobin, pI 6.8/7.2; trypsinogen, pI 9.3. The pI of NaoA was determined from a standard curve of pI and migration distance (cm) of protein standards. E...

Ngày tải lên: 31/03/2014, 08:20

6 255 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢.ThethirdPCRwas carried ... proliferation assay We next analyzed the ability of recombinant SSA to stimulate human T-cells. All SSA preparations yielded Fig. 1. SDS/PAGE and immunoblot...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya Suriya Department ... sialidasetypeX,protease enzymes and molecular mass standards were purchased from Sigma. Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemont...

Ngày tải lên: 21/02/2014, 00:20

8 617 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )...

Ngày tải lên: 21/02/2014, 03:20

10 564 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose ... DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢. One strand...

Ngày tải lên: 07/03/2014, 11:20

16 543 0
Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

... Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans Akihiro Morita 1 , Haruhiko Isawa 2 , ... Western blot analysis of triplatin-1 and -2 from the salivary gland of T. infestans. Extracts from a pair of salivary glands, recom- binant triplatin-1 and recombin...

Ngày tải lên: 30/03/2014, 10:20

8 408 0
Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

... T A P T A K P R L R G 241-AATAAGCCTTGAATCAATGATGTTCTATTTTTTATAGCGTCCCGATGGCGGTGATGTTGT -N K P * 301-AGGCTGGAAGCAAATAAAAATACGAAGAGTGACTTCAAAAAAAAAAAAAAAAAAAAAAAA A 1-GCTTTGACGGCAATGAAGCACTTCGTAATTTTGATTCTTGCTGTTGTGGCCAGTGCCGTG ... R 241-CAAAATCAGGATTGAATCAATGGTGTTCTAGATTTCTATAACCTACCGACGGCGGCAATT Q N Q D * 301-TTGTGGGGTCCAAACAAATAAAACTACAAAGTGGGACCTCAAAAAAAAAAAAAAAAAAAA B Madanin-1...

Ngày tải lên: 31/03/2014, 01:20

9 337 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... compo- nents of each reaction mixture, after their chromatographic separation and purification, were submitted to 1 HNMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses ... The concentration of both the assayed compound and its respective transformation product was determined by comparison of peak data with those obtained from authentic stand...

Ngày tải lên: 08/03/2014, 08:20

10 624 0
w