Báo cáo khoa học: Broad antibiotic resistance profile of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx

... reverse: (5¢-GATCTTGCTGCTTACT GCGGCTCACTACGACC ATACAGG-3¢) (5¢-GCACCTGTATGGTCGTAGTGAGC CGCAGTAAG CAGC-3¢) For the Q116N mutant forward and reverse: (5¢-GATCTTGCTGCTTACT AACGCTCACTACGACC ATACAGG-3¢) (5¢-GCACCTGTATGGTCGTAGTGAGC GTTAGTAAG CAGC-3¢) For ... reverse: (5¢-GATCTTGCTGCTTACT AACGCTCACTACGACC ATACAGG-3¢) (5¢-GCACCTGTATGGTCGTAGTGAGC GTTAGTAAG CAGC-3¢) For the Q116H mutant forward and...

Ngày tải lên: 14/03/2014, 23:20

... the program GNOMOKO [24]. The molecular masses were calculated from the ratio of the forward scattering intensity of the samples and of the molecular mass standard BSA. The volume fractions of monomers, ... large amounts of indole-3-acetic acid. Indolepyruvate decarboxylase, the key enzyme in the biosynthetic pathway of indole-3-acetic acid, catalyses the for...

Ngày tải lên: 08/03/2014, 02:20

... calculated from the measured relaxation parameters, that contain contribu- tions from the overall as well as the local dynamics. Graphical analysis of the spectral density values pro- vides a ... the similar values of the mean and weighed mean s e . Helix II shows the largest variability in local fluctua- tion frequency, despite the fact that the relative mean generaliz...

Ngày tải lên: 18/02/2014, 16:20

... for the catalytic modules of other polymerases [11]. Furthermore, the conservation of catalytic aspartate residues and their 3D arrangement suggest that the catalysis mode is probably comparable with ... domain performs no primase activity; and (b) after the best possible fit of the Ca atoms of the catalytic triad, are positional homologs of the R148 and K300 residues...

Ngày tải lên: 18/02/2014, 18:20

... years as a result of the expansion of the Aedes aegypti mosquito to dif- ferent geographic areas, and DHF has spread from South East Asia to the Western Pacific and the Americas. A substantial ... epitopes of the others [63]. The major pharmaceutical companies are currently developing a treatment against the disease. A tetra- valent live attenuated vaccine was devel...

Ngày tải lên: 19/02/2014, 00:20

... of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleo- tides 1–17), a six-nucleotide ... transcription enhancer, an EcoRI restriction site, 14 nucleotides of authentic 5¢ exon, and the first two nucleotides of the Cr.LSU intron. Oligo 158 (26 nucleotides,...

Ngày tải lên: 19/02/2014, 07:20

... Escherichia coli. Acta Crystallogr. D 58, 853–855. 12. Yamada, Y., Fujiwara, T., Sato, T., Igarashi, N. & Tanaka, N. (2002) The 2. 0A ˚ crystal structure of catalase-peroxidase from Haloarcula marismortui. ... peroxidase (strain 0157:H7) Escherichia coli EuglgraAPX Q8LP26 Ascorbate peroxidase Euglena gracilis FraganaAPX O48919 Ascorbate peroxidase Fragaria x ananassa GaldparAPX Q8GT2...

Ngày tải lên: 19/02/2014, 16:20

... matching with the C-terminal sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG. For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT. ... subtraction of the spontaneous release of the basophils, the allergen- induced histamine release was calculated as percent of the total amount...

Ngày tải lên: 21/02/2014, 00:20

... peptides was proposed as the reason of this apparent increased uptake, as the rate of uptake was thesameinserum-freemedium[17].Asalreadystated above, this Tat CPP peptide is able to vectorize various cargo ... T at peptide uptake i s under evaluation. Comparative FACS analysis of the internalization of the full-length Tat protein construct and the Tat CPP Differences in the...

Ngày tải lên: 21/02/2014, 03:20

... signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the Ca and ... of the protein backbone, and for more than 78% of the side chain atoms. The main set of backbone u and w dihedral angles was calculated from the chemical shift val...

Ngày tải lên: 06/03/2014, 11:20