Báo cáo khoa học: Broad antibiotic resistance proﬁle of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx

... reverse:(5¢-GATCTTGCTGCTTACTGCGGCTCACTACGACCATACAGG-3¢)(5¢-GCACCTGTATGGTCGTAGTGAGCCGCAGTAAGCAGC-3¢)For the Q116N mutant forward and reverse:(5¢-GATCTTGCTGCTTACTAACGCTCACTACGACCATACAGG-3¢)(5¢-GCACCTGTATGGTCGTAGTGAGCGTTAGTAAGCAGC-3¢)For ... reverse:(5¢-GATCTTGCTGCTTACTAACGCTCACTACGACCATACAGG-3¢)(5¢-GCACCTGTATGGTCGTAGTGAGCGTTAGTAAGCAGC-3¢)For the Q116H mutant forward and reverse:(5¢-GATCTTGCTGCTTACTCATGCTCACTACGACCATACAGG-3¢)(5¢-GCACCTGTATGGTCGTAGTGAGCATGAGTAAGCAGC-3¢)Production and ... 2011 The Authors Journal compilation ª 2011 FEBS 1263 Broad antibiotic resistance proﬁle of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme Louise E. Horsfall1, Youssef Izougarhane1,...

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... the programGNOMOKO[24]. The molecular masses were calculated from the ratio of the forward scattering intensity of the samples and of the molecular mass standard BSA. The volume fractions of monomers, ... large amounts of indole-3-acetic acid.Indolepyruvate decarboxylase, the key enzyme in the biosynthetic pathway of indole-3-acetic acid, catalyses the formation of indole-3-acetaldehyde and carbon ... EcIPDC, a discontinuousassay based on HPLC was used [7]. To analyse the kineticbehaviour of the enzyme in more detail, a coupled opticalassay was elaborated with alcohol dehydrogenase asauxiliary...

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... calculated from the measured relaxation parameters, that contain contribu-tions from the overall as well as the local dynamics.Graphical analysis of the spectral density values pro-vides a ... the similar values of the mean and weighed mean se.Helix II shows the largest variability in local ﬂuctua-tion frequency, despite the fact that the relative meangeneralized order parameter and the ... from the MF-based ﬁtting of the majority of the TTF-1 HD relaxa-tion data could be attributed to correlated localdynamics that occur on a timescale similar to that of the overall tumbling.Graphical...

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... for the catalytic modules of otherpolymerases [11]. Furthermore, the conservation of catalytic aspartate residues and their 3D arrangementsuggest that the catalysis mode is probably comparablewith ... domain performs no primaseactivity; and (b) after the best possible ﬁt of the Caatoms of the catalytic triad, are positional homologs of the R148 and K300 residues of P. furiosus archaealprimase, ... novel family of AEPs which are sporadically found in both bacterio-phages and crenarchaeal and Gram-positive bacterialplasmids. In a recent description, they are said to betypiﬁed by the RepA-like...

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... years as a result of the expansion of the Aedes aegypti mosquito to dif-ferent geographic areas, and DHF has spread fromSouth East Asia to the Western Paciﬁc and the Americas. A substantial ... epitopes of the others [63]. The major pharmaceutical companies are currentlydeveloping a treatment against the disease. A tetra-valent live attenuated vaccine was developed at the Walter Reed Army ... clinical phases Ior II, and prevention through vaccination has become a major priority on the agendas of the World Health Organization and of national ministries of health and military organizations....

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTCACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)contains, in order, a T7 RNA polymerase promoter (nucleo-tides 1–17), a six-nucleotide ... transcription enhancer, anEcoRI restriction site, 14 nucleotides of authentic 5¢ exon,and the ﬁrst two nucleotides of the Cr.LSU intron. Oligo 158(26 nucleotides, GAAATT TTAAAGCCGAATAAAACTTG)ends ... especially the intron from the large rRNA gene of Tetrahymena thermophila(Tt.LSU), indicate that some domains are modular,and that the catalytic site is buried inside the foldedribozyme [5–7]. The...

Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx

... Escherichiacoli. Acta Crystallogr. D 58, 853–855.12. Yamada, Y., Fujiwara, T., Sato, T., Igarashi, N. & Tanaka, N.(2002) The 2. 0A ˚crystal structure of catalase-peroxidase fromHaloarcula marismortui. ... peroxidase(strain 0157:H7)Escherichia coliEuglgraAPX Q8LP26 Ascorbate peroxidase Euglena gracilisFraganaAPX O48919 Ascorbate peroxidase Fragaria x ananassaGaldparAPX Q8GT26 Hybrid-type ascorbate peroxidase(Rhodophyta)Galdieria ... Structural comparison of four representatives of class I of the superfamily of bacterial, fungal, and plant peroxidases. (A) N-terminal domainand (B) C-terminal domain of catalase–peroxidase from Haloarcula...

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... matchingwith the C-terminal sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For ampliﬁcation of the long isoform the same 5¢ primers were used, the 3¢speciﬁc primer was FF3B: 5¢TTACAAGTCTTGCAAAGGGAAGGAT. ... subtraction of the spontaneous release of the basophils, the allergen-induced histamine release was calculated as percent of the total amount of histamine determined after lysis of the basophils by twofold ... incubation of the blot strips.Circular dichroism (CD) spectroscopy of naturaland recombinant b-fructofuranosidase The CD spectra of the natural Lyc e 2 as well as of the largerrecombinant isoform...

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

... peptides was proposed as the reason of this apparent increased uptake, as the rate of uptake wasthesameinserum-freemedium[17].Asalreadystatedabove, this Tat CPP peptide is able to vectorize variouscargo ... T at peptide uptake i sunder evaluation.Comparative FACS analysis of the internalization of the full-length Tat protein construct and the Tat CPPDifferences in the mechanisms of internalization ... ncubation of the cells did not impair dramatically the Tat peptideuptake while it abolished the uptake of the GFP-fused Tatprotein as expected. Translocation at low temperature wasinitially described...

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the Ca and ... of the protein backbone, and formore than 78% of the side chain atoms. The main set of backbone u and w dihedral angles wascalculated from the chemical shift values of backboneatoms13Ca,13Cb,13C¢,1Ha,1HN, ... Ebihara K & Nakamura Y (1998) The stretch of C-terminal acidic amino acids of translational releasefactor eRF1 is a primary binding site for eRF3 of ﬁssion yeast. RNA 4, 958–972.10 Ebihara...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ