Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

... Authors Journal compilation ª 2011 FEBS 2089 Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity Miguel A. Pardo-Cea 1, *, ... the polar character and the possibil- ity of donating H-bonds. In the Y111N variant, the aromatic ring is replaced by a group which is also structural...

Ngày tải lên: 14/03/2014, 23:20

... Social media and young adults. Ian Mackinnon. 2006. Age and geographic inferences of the livejournal social network. In In Statistical Network Analysis Workshop. Andrew Y Ng and Michael I Jordan. 2002. ... dictionary and n-gram based content analysis and achieved 91.5% accuracy using an SVM classifier. We also use a super- vised machine learning approach, but classifica- tion b...

Ngày tải lên: 07/03/2014, 22:20

... lemmas and part -of- speech tags, e.g. took, take, VBD and began, begin, VBD. • All words, lemmas and part -of- speech tags in the verb phrases of each event, e.g. took, take, VBD and began, to, trade, ... existing corpora are missing some crucial pieces for study- ing temporal-causal interactions. Our research aims to fill these gaps by building a corpus of parallel tempor...

Ngày tải lên: 08/03/2014, 01:20

Ngày tải lên: 21/02/2014, 20:20

... we renamed low, middle, and high. Our chosen method of data exploration was Multivariate Analysis of Variance (MANOVA). An initial concern was to put the samples on equal footing despite the fact ... demon- strated mastery can be assumed to be acquired as well. Those structures which are well be- yond the user’s area of variable performance (his or her current area of learning...

Ngày tải lên: 17/03/2014, 07:20

... this abstraction was to consider each participant (individuals or properties) either as a localized entity (a token) or a location (a place), and to determine its role in the realization of ... sur le cargo~the crate was embarked on the cargo boat, and is schematized in (2). One of the argument (cargo boat) is used as a localization while the other argument is used...

Ngày tải lên: 17/03/2014, 08:20

... 5¢-CTGGCATATGAGCGATAAAATTATTCAC- 3¢ and reverse 5¢-CCGGGGATCCCTGAAAATACAGG TTTTCGGTCGTTGGGATATCGTAATCGTGATGGTG ATGGTGATGCATATG-3¢. The rrPar-4FL construct (residues 1–332, rat sequence numbering) was prepared ... PCR amplification using the four primers 5¢-CAGGGATCCATGGCGACCGGCG GCTATCGGAG-3¢,5¢-CTTGGCGGCTGGATCTCCGCC GCTCGAAC-3¢,5¢-GTTCGAGCGGCGGAGATCCAGCC GCCAAG-3¢ and 5¢-CAGGTCGACTTACCTTG...

Ngày tải lên: 16/03/2014, 02:20

... cofactor loading into TorA [11–18], and additionally operates as a Tat proofreading chaperone, binding directly to the TorA twin-arginine signal peptide [5,19,20]. TorD belongs to a family of ... 3. TorD GTPase activity can be isolated by Cibacron Blue affin- ity chromatography. (A) Unusual behaviour of TorD on CibacronÔ Blue affinity media. A sample of 0.5 m M metal affinity c...

Ngày tải lên: 16/02/2014, 09:20

... necrosis factor -a mRNA, a prototype of ARE- containing mRNAs, in macrophage cell extracts [45]. Similar to TIAR, all three proteins display a major nuclear locali- zation, suggesting that the association ... anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnR...

Ngày tải lên: 16/02/2014, 15:20

... phyla like cnidaria or nematodes and four major forms in mammals, designated A- type (lamin A and lamin C) and B-type (lamin B1 and lamin B2), in addition to an increasing number of associated ... AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al. (2005) Alterations of nuclear envel- ope and chromatin organization in mandibuloacral dys- plasia, a rare form of l...

Ngày tải lên: 19/02/2014, 02:20