Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc
... 5¢-GCCGGATCCATGACTGTG GTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGG AGCTCTTACTGTAGAGCATGTTGGAAATA-3¢. Full- length cDNA of HsGrx3 and MmGrx3 were amplified by PCR using gene-specific primers. For ... specifically targeting human Grx3 sequences were purchased from Sigma- Aldrich. The human Grx3 shRNA1 sequence is 5¢-CCG GGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTC CTTTCATAAAGAGCTTTTTG-3¢. The human...
Ngày tải lên: 14/03/2014, 23:20
... syntactical features. We evaluated our approach on large- scale Japanese-English and English-Japanese machine translation tasks, and show that it can significantly outperform the baseline phrase- based ... tokens for both English and Japanese. This monolingual corpus is used to train a 4-gram language model for English and Japanese respectively. 5.2 Parsers For English, we train a...
Ngày tải lên: 19/02/2014, 19:20
... Precision-Order-Recall MT Evaluation Metric for Tuning Boxing Chen, Roland Kuhn and Samuel Larkin National Research Council Canada 283 Alexandre-Taché Boulevard, Gatineau (Québec), Canada J8X 3X7 ... third data condition is a French-to-English (fr-en). The parallel training data is from Canadian Hansard data, containing 59.3M word tokens. We used two LMs in loglinear com...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A study of Information Retrieval weighting schemes for sentiment analysis" doc
... used as the “gold standard” 7 . Documents are annotated at the document-level, rather than at the post level, making this data set somewhat noisy. Additionally, the data set is par- ticularly large ... provide a small advantage in this data set although the actual idf variant isn’t important, e.g. btc, bt ′ c, and okc all perform similarly. The utilized tf variant also isn’t important, e....
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "A Comparison of Alternative Parse Tree Paths for Labeling Semantic Roles" ppt
... branches that are easiest to align with substrings that have been annotated with semantic role information? 3. What is the relative precision and recall per- formance of parse tree paths formulated ... predicate-argument relationship, and could be encoded in various ways that take ad- vantage of the additional semantic and lexical information that is provided. To compare traditional...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx
... demonstrates that we achieve a much greater impact on performance with carefully designed, automatically extractable context ori- ented features. In all cases we are able to achieve a statistically ... Learner, in all cases we evaluate com- binations of alternative history sizes (0 and 1) and alternative feature sets (base and base+AllContext). In our experimentation we have evaluate...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "A Limited-Domain English to Japanese Medical Speech Translator Built Using REGULUS 2" doc
... Hospital 2500 Grant Road Mountain View, CA 94040 vvandal3@aol.com Hitoshi Isahara, Kyoko Kanzaki Communications Research Laboratory 3-5 Hikaridai Seika-cho, Soraku-gun Kyoto, Japan 619-0289 {isahara,kanzaki}@crl.go.jp Beth ... patterns are derived from a single large linguistically motivated unification grammar; thus the compile-time architecture is that of a linguisti- cally motivated s...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... estimators — ME estimation with L 1 or L 2 regularization, and AP — are in a near sta- tistical tie for first place. 1 Introduction Parameter estimation is fundamental to many sta- tistical approaches ... were trained discriminatively on an adaptation domain corpus (Encarta Encyclopedia). Thus, this forms a cross domain adaptation paradigm. This also implies that the portion...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Re-examination of Machine Learning Approaches for Sentence-Level MT Evaluation" ppt
... corre- lations with human assessment are higher than stan- dard automatic evaluation metrics. 2 MT Evaluation Recent automatic evaluation metrics typically frame the evaluation problem as a comparison ... text?) and fluency (does the translation sound natural in the target lan- guage?). These human assessment data are an in- valuable resource for measuring the reliability of au- tomatic ev...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Meta-Level Grammar: Redefining Synchronous TAG for Translation and Paraphrase" doc
... edu. au Abstract In applications such as translation and paraphrase, operations are carried out on grammars at the meta level. This pa- per shows how a meta-grammar, defining structure at ... area, for example using S-TAG for English-Korean machine trans- lation in a practical system (Palmer et al, 1998). In mapping between, say, English and French, there is a lexicali...
Ngày tải lên: 08/03/2014, 06:20