Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGG ARA439 GGAATTC CATATGCGTATTATGGCCAG ARA440 TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 ... CGGCGCGT CATATGGCCAGTCATGATA ARA457 TGATACG CATATGTCACCGGCTGGC ARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATG...

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... (Ga- napathibhotla and Liu, 2008). Our annotation scheme stands on the following assumptions: (i) the sentence is the unit of analysis, whose interpretation may require the analysis of the ... states were manually annotated. The annotation was per- formed at word and phrase level, and the sentiment expressions identified in the corpus were asso- ciated to the...

Ngày tải lên: 20/02/2014, 05:20

5 499 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a ... cycle Cell survival miR-278 Site1: Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCU site2: Expanded UTR 5´ AGAUGGUAAAAUACACGAG CC...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... tubingensis (CAA68128.1), Pgx2 Arabi- dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren- theses. A question mark indicates ... temperatures. Although bacterial exo-acting polygalacturonases commonly generate digalacturonate, PelB was shown to liberate monogalacturonic acid as the first and...

Ngày tải lên: 20/02/2014, 03:20

10 592 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... using partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 ... (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢)...

Ngày tải lên: 21/02/2014, 03:20

11 507 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... 2002 Characterization and regulation of yeast Ca 2+ -dependent phosphatidylethanolamine-phospholipase D activity Xiaoqing Tang, Michal Waksman, Yona Ely and Mordechai Liscovitch Department of Biological ... mutants, bearing mutations at the early and late stages of the secretory pathway, for changes in PtdEtn-PLD activity at room temperature and at the restrictive temp...

Ngày tải lên: 22/02/2014, 07:20

10 499 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... gradually increased, reaching a peak at the wandering stage late in the last larval stadium. At the prepupal stage, EH activity declined to a level equal to that in the early time of the stadium. ... the 5¢-end of the ORF and contained a SalIsite(5¢-CTACGTCGACGATGGCGAA CATCTGGCCACGAATC-3¢); the reverse primer corres- ponded to the 3¢-end of the ORF and cont...

Ngày tải lên: 07/03/2014, 21:20

10 379 0
Báo cáo khoa học: Function and regulation of ABCA1 – membrane meso-domain organization and reorganization pptx

Báo cáo khoa học: Function and regulation of ABCA1 – membrane meso-domain organization and reorganization pptx

... 2 (JAK2) and casein kinase (CK2) are involved in the regulation of ABCA1 activity and stability by apoA-I. The inter- action of apoA-I with ABCA1 increases the cellular cAMP content and ABCA1 ... Tanaka M, Ota A, Sandoval JC, Nakagawa-Toyama Y, Sato SB, Kobayashi T et al. (2007) Increased lipid rafts and accelerated lipopolysaccharide-induced tumor necrosis factor alpha s...

Ngày tải lên: 22/03/2014, 15:21

14 343 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... belong to the family of serine hydrolases and share structural and functional characteristics, including a catalytic triad, an a ⁄ b- hydrolase fold and a cofactor independent activity. The catalytic ... FEBS GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAA GTTATTGAGATCGTCG-3¢, respec- tively (the underlining indicates the m...

Ngày tải lên: 23/03/2014, 09:20

11 461 0
Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

... serving as baseline value for the other data, thereby representing the status of both groups of unstimu- lated human primary dermal fibroblasts. Statistical analysis Statistical analysis was performed ... fractions. The ETA-receptor was enriched in membrane fractions as revealed by two specific bands, a predominant band of approximately 55 kDa and a less prominent one of app...

Ngày tải lên: 23/03/2014, 11:20

13 548 0
w