Monochorionic triamniotic triplet pregnancy with a co-triplet fetus discordant for congenital cystic adenomatoid malformation of the lung ppt

... congenital cystic adenomatoid malformation of the lung Ahmet Gul* 1 , Halil Aslan 1 , Altan Cebeci 1 , Yavuz Ceylan 1 and Ali Ismet Tekirdag 2 Address: 1 Maternal and Fetal Unit, Istanbul Bakirkoy ... adenomatoid malformation (CCAM). Case presentation A 26 year-old woman was referred to our maternal and fetal unit for detailed ultrasonographic examination because of...

Ngày tải lên: 14/03/2014, 16:20

... The most reliable way of exploring this is comparison of crystal structure data. The only data so far available are for sweet potato (Ipomoea batata) catechol oxidase [26]. The catalytic copper ... shows the rate of TH activity as a function of the concentration of l-dopa cofactor added to the assay mixture. R3-1501 – extracts have a high TH activity, almost indepe...

Ngày tải lên: 19/02/2014, 07:20

... males, spermatophores accum- ulate in the distal part of the Needham sac. However, in the Argonautoidea superfamily only one large sper- matophore is formed in the spermatophore gland and passed to the Needham sac. Afterwards its contents appear in ... male cephalopods, stages IV and Vare short and perhaps of little ecological importance since they have to accumulate a large q...

Ngày tải lên: 14/03/2014, 16:20

... (not shown) we obtained inadequate ratios; for our assays, we aim for at least a 10 : 1 ratio. It was reasoned that with some cDNAs, even the low mRNA levels in the off-state generate, because of highly ... OCT1h mRNA was reduced as compared with pEBTet by a factor of nine in the on-state and by a factor of 26 in the off-state (Table 1). With pEBTetD, we obtained...

Ngày tải lên: 23/03/2014, 09:21

... choose the N best candidates for each sentence from the set of candidates ap- pearing in that sentence and the candidates that are already in the cache. Following this cache model, named the dynamic ... if the zero-anaphora res- olution in the current utterance is performed cor- rectly, it will be available for use as information about the recency of candidates and th...

Ngày tải lên: 30/03/2014, 23:20

Ngày tải lên: 03/01/2014, 19:36

... GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTC...

Ngày tải lên: 18/02/2014, 13:20

... some of the features of the standards: • Definition of a consensual management scope and therefore an AUM amount based on an established and audited methodology • Determination of the management ... increased access to information about the art market, with the establishment of art price service providers and market analysts, and a range of fine art price ind...

Ngày tải lên: 19/02/2014, 09:20

... of Thebes and Memphis, of Rome and Athens and Jerusalem, of Delhi and of Bagdad, of the Pyramids and of the Parthenon the radiant names of Hammurabi and Zarathustra and Moses and the Buddha and ... discovered), in the Gaboon, along the lower Zambesi, and in the Benua and Shari basins, the African aborigines present almost a greater uniformity of physical and...

Ngày tải lên: 19/02/2014, 11:20

... regular inventory of hazardous materials/chemicals maintained? Are discrepancies in daily inventory of hazardous materials/chemicals immediately investigated? Are the storage areas for hazardous ... in-plant irradiation equipment and materials restricted? Are records maintained to allow easy trace-back of raw materials to suppliers? Are records maintained so as to allow easy...

Ngày tải lên: 21/02/2014, 01:20